ID: 1012889777

View in Genome Browser
Species Human (GRCh38)
Location 6:104885326-104885348
Sequence ATGCTACCCCCGGAGGAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012889773_1012889777 30 Left 1012889773 6:104885273-104885295 CCTGCACTCTCATATATGTGCAC No data
Right 1012889777 6:104885326-104885348 ATGCTACCCCCGGAGGAGTTAGG No data
1012889774_1012889777 3 Left 1012889774 6:104885300-104885322 CCTACTCTTTCTTCATGACTCAA No data
Right 1012889777 6:104885326-104885348 ATGCTACCCCCGGAGGAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012889777 Original CRISPR ATGCTACCCCCGGAGGAGTT AGG Intergenic
No off target data available for this crispr