ID: 1012892005

View in Genome Browser
Species Human (GRCh38)
Location 6:104907577-104907599
Sequence AAGGAAAGCACAGTGATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012892003_1012892005 -8 Left 1012892003 6:104907562-104907584 CCGTGCGTTTGGGAGAAGGAAAG No data
Right 1012892005 6:104907577-104907599 AAGGAAAGCACAGTGATTGTGGG No data
1012891998_1012892005 25 Left 1012891998 6:104907529-104907551 CCCAGTGGCAGTTGCATGGCATG No data
Right 1012892005 6:104907577-104907599 AAGGAAAGCACAGTGATTGTGGG No data
1012891997_1012892005 26 Left 1012891997 6:104907528-104907550 CCCCAGTGGCAGTTGCATGGCAT No data
Right 1012892005 6:104907577-104907599 AAGGAAAGCACAGTGATTGTGGG No data
1012891999_1012892005 24 Left 1012891999 6:104907530-104907552 CCAGTGGCAGTTGCATGGCATGA No data
Right 1012892005 6:104907577-104907599 AAGGAAAGCACAGTGATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012892005 Original CRISPR AAGGAAAGCACAGTGATTGT GGG Intergenic
No off target data available for this crispr