ID: 1012893077

View in Genome Browser
Species Human (GRCh38)
Location 6:104919191-104919213
Sequence TTCTGCCCTCATTTTGAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012893077_1012893084 11 Left 1012893077 6:104919191-104919213 CCCCCCTCAAAATGAGGGCAGAA No data
Right 1012893084 6:104919225-104919247 CTTGTTTATTTCCATATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012893077 Original CRISPR TTCTGCCCTCATTTTGAGGG GGG (reversed) Intergenic
No off target data available for this crispr