ID: 1012893084

View in Genome Browser
Species Human (GRCh38)
Location 6:104919225-104919247
Sequence CTTGTTTATTTCCATATCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012893074_1012893084 16 Left 1012893074 6:104919186-104919208 CCCTGCCCCCCTCAAAATGAGGG No data
Right 1012893084 6:104919225-104919247 CTTGTTTATTTCCATATCTCTGG No data
1012893071_1012893084 18 Left 1012893071 6:104919184-104919206 CCCCCTGCCCCCCTCAAAATGAG No data
Right 1012893084 6:104919225-104919247 CTTGTTTATTTCCATATCTCTGG No data
1012893077_1012893084 11 Left 1012893077 6:104919191-104919213 CCCCCCTCAAAATGAGGGCAGAA No data
Right 1012893084 6:104919225-104919247 CTTGTTTATTTCCATATCTCTGG No data
1012893079_1012893084 9 Left 1012893079 6:104919193-104919215 CCCCTCAAAATGAGGGCAGAAAC No data
Right 1012893084 6:104919225-104919247 CTTGTTTATTTCCATATCTCTGG No data
1012893081_1012893084 7 Left 1012893081 6:104919195-104919217 CCTCAAAATGAGGGCAGAAACCA No data
Right 1012893084 6:104919225-104919247 CTTGTTTATTTCCATATCTCTGG No data
1012893072_1012893084 17 Left 1012893072 6:104919185-104919207 CCCCTGCCCCCCTCAAAATGAGG No data
Right 1012893084 6:104919225-104919247 CTTGTTTATTTCCATATCTCTGG No data
1012893078_1012893084 10 Left 1012893078 6:104919192-104919214 CCCCCTCAAAATGAGGGCAGAAA No data
Right 1012893084 6:104919225-104919247 CTTGTTTATTTCCATATCTCTGG No data
1012893076_1012893084 15 Left 1012893076 6:104919187-104919209 CCTGCCCCCCTCAAAATGAGGGC No data
Right 1012893084 6:104919225-104919247 CTTGTTTATTTCCATATCTCTGG No data
1012893080_1012893084 8 Left 1012893080 6:104919194-104919216 CCCTCAAAATGAGGGCAGAAACC No data
Right 1012893084 6:104919225-104919247 CTTGTTTATTTCCATATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012893084 Original CRISPR CTTGTTTATTTCCATATCTC TGG Intergenic
No off target data available for this crispr