ID: 1012895183

View in Genome Browser
Species Human (GRCh38)
Location 6:104939975-104939997
Sequence ATATATACACATATTTAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012895183_1012895185 6 Left 1012895183 6:104939975-104939997 CCAAGCTAAATATGTGTATATAT No data
Right 1012895185 6:104940004-104940026 ATTTTTGGCCCCAGATCTTGTGG No data
1012895183_1012895184 -9 Left 1012895183 6:104939975-104939997 CCAAGCTAAATATGTGTATATAT No data
Right 1012895184 6:104939989-104940011 TGTATATATCACAGTATTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012895183 Original CRISPR ATATATACACATATTTAGCT TGG (reversed) Intergenic
No off target data available for this crispr