ID: 1012895262

View in Genome Browser
Species Human (GRCh38)
Location 6:104940501-104940523
Sequence CCGCGGTGGAGCTTTACCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 17
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 16}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012895262_1012895267 -5 Left 1012895262 6:104940501-104940523 CCCGCGGTAAAGCTCCACCGCGG 0: 1
1: 0
2: 0
3: 0
4: 16
Right 1012895267 6:104940519-104940541 CGCGGCCGCGCTCGCCCGCCCGG 0: 1
1: 0
2: 3
3: 35
4: 282
1012895262_1012895275 14 Left 1012895262 6:104940501-104940523 CCCGCGGTAAAGCTCCACCGCGG 0: 1
1: 0
2: 0
3: 0
4: 16
Right 1012895275 6:104940538-104940560 CCGGCCCTGGAATGAATGGAAGG No data
1012895262_1012895272 10 Left 1012895262 6:104940501-104940523 CCCGCGGTAAAGCTCCACCGCGG 0: 1
1: 0
2: 0
3: 0
4: 16
Right 1012895272 6:104940534-104940556 CCGCCCGGCCCTGGAATGAATGG No data
1012895262_1012895269 1 Left 1012895262 6:104940501-104940523 CCCGCGGTAAAGCTCCACCGCGG 0: 1
1: 0
2: 0
3: 0
4: 16
Right 1012895269 6:104940525-104940547 CGCGCTCGCCCGCCCGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012895262 Original CRISPR CCGCGGTGGAGCTTTACCGC GGG (reversed) Intergenic