ID: 1012900347

View in Genome Browser
Species Human (GRCh38)
Location 6:104997782-104997804
Sequence TAGCTAAGGCTGACACTTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012900342_1012900347 14 Left 1012900342 6:104997745-104997767 CCGGGTTCATATCCCATAAAAAT 0: 1
1: 0
2: 0
3: 14
4: 195
Right 1012900347 6:104997782-104997804 TAGCTAAGGCTGACACTTCCGGG No data
1012900344_1012900347 1 Left 1012900344 6:104997758-104997780 CCATAAAAATTAGTCTTAGCACA 0: 1
1: 0
2: 4
3: 14
4: 200
Right 1012900347 6:104997782-104997804 TAGCTAAGGCTGACACTTCCGGG No data
1012900343_1012900347 2 Left 1012900343 6:104997757-104997779 CCCATAAAAATTAGTCTTAGCAC 0: 1
1: 0
2: 2
3: 13
4: 162
Right 1012900347 6:104997782-104997804 TAGCTAAGGCTGACACTTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012900347 Original CRISPR TAGCTAAGGCTGACACTTCC GGG Intronic
No off target data available for this crispr