ID: 1012908891

View in Genome Browser
Species Human (GRCh38)
Location 6:105097445-105097467
Sequence GACGCCACGCCCGCTGGGAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 69}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012908886_1012908891 12 Left 1012908886 6:105097410-105097432 CCTTGGGGCTGCAACGTGGCATC 0: 1
1: 0
2: 0
3: 12
4: 92
Right 1012908891 6:105097445-105097467 GACGCCACGCCCGCTGGGAAGGG 0: 1
1: 0
2: 0
3: 16
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012908891 Original CRISPR GACGCCACGCCCGCTGGGAA GGG Exonic
901586936 1:10303598-10303620 GACGTCATGGCCACTGGGAAAGG + Intronic
902691272 1:18111150-18111172 GAGGCCCCGCCCAGTGGGAAGGG - Intronic
903907434 1:26696595-26696617 GCCGCCGCAGCCGCTGGGAAAGG + Exonic
907140480 1:52181497-52181519 GCCGCCACCCCGTCTGGGAAGGG + Intronic
909497781 1:76298594-76298616 GACACCACTCCCACTGGGACAGG - Intronic
923065676 1:230515123-230515145 GAGGCCACCCTTGCTGGGAAAGG + Intergenic
1069430817 10:68332475-68332497 GAGGCCAAGCCAGCAGGGAAAGG - Intronic
1076476104 10:130752561-130752583 GAGGCCACTCACGCTGGGGACGG - Intergenic
1078068626 11:8094211-8094233 GAGGCCAGGCCTGCTGGGGAGGG - Intronic
1079560305 11:21812511-21812533 GTCACCGCGCCCGCCGGGAATGG + Intergenic
1081688511 11:45059172-45059194 GATGCCAAGCCCGGTGGGAGTGG + Intergenic
1081725197 11:45322992-45323014 GACGCCAGGCTCGCTGGGGAAGG - Intergenic
1083238926 11:61371388-61371410 GACCCCACACCCCCAGGGAAAGG + Intergenic
1095951021 12:47781994-47782016 GAGGCCAGGCCAGATGGGAAAGG + Exonic
1100619446 12:96257016-96257038 GATCCCACGGCTGCTGGGAAAGG - Intronic
1122807940 14:104270121-104270143 GACGCCACCCACCCTGGGGAGGG + Intergenic
1125032024 15:35082815-35082837 GACGCTACCCCATCTGGGAAGGG + Intergenic
1127910681 15:63413597-63413619 GAAGCCTCGCTCCCTGGGAAAGG + Intergenic
1131961246 15:97792355-97792377 GCCCCCACGCTGGCTGGGAAGGG + Intergenic
1140843295 16:78862782-78862804 GAAGCCACCCACACTGGGAAGGG + Intronic
1144604566 17:16653493-16653515 GCCGCCAGGCCCGCAGGGAGGGG + Intronic
1147819649 17:43234206-43234228 GAGGCCACGCCCTCTGTGAAAGG - Intergenic
1147820957 17:43241601-43241623 GAGGCCACGCCCTCTGTGAAAGG - Intergenic
1147821765 17:43246093-43246115 GAGGCCACGCCCTCTGTGAAAGG - Intergenic
1147822857 17:43252248-43252270 GAGGCCACGCCCTCTGTGAAAGG - Intergenic
1147825375 17:43267052-43267074 GAGGCCACGCCCTCTGTGAAAGG - Intergenic
1147826498 17:43273519-43273541 GAGGCCACGCCCTCTGTGAAAGG - Intergenic
1147827387 17:43278397-43278419 GAGGCCACGCCCTCTGTGAAAGG - Intergenic
1147828495 17:43284558-43284580 GAGGCCACGCCCTCTGTGAAAGG - Intergenic
1147829604 17:43290710-43290732 GAGGCCACGCCCTCTGTGAAAGG - Intergenic
1147830695 17:43296844-43296866 GGAGCCACGCCCTCTGTGAAAGG - Intergenic
1147831381 17:43300460-43300482 GAGGCCACGCCCTCTGTGAAAGG - Intergenic
1147843358 17:43388343-43388365 GTGGCCACGCCTCCTGGGAAAGG - Intergenic
1150230988 17:63550433-63550455 GCCGCCCCGCCCTCTCGGAACGG - Intergenic
1151548462 17:74807553-74807575 GATGACCCGCCCACTGGGAAAGG - Intronic
1151836642 17:76586352-76586374 GACGCCAGGACAGCTGGGAGGGG + Intronic
1152654178 17:81512459-81512481 GAGGCCACGGCCGCTGGGGTTGG - Exonic
1152875768 17:82785515-82785537 GACGCCCCTCCCGCTGCGATGGG - Intronic
1154167707 18:12028434-12028456 GACGCCAGGCCCCCTCGGGAAGG - Intronic
1155539579 18:26854465-26854487 GTGGCCACGCCCCCTGAGAAAGG + Exonic
1156235898 18:35204511-35204533 GACACCACGCTGGCTGGGACAGG - Intergenic
1157396016 18:47342003-47342025 GACCTCAGGCCCGCTTGGAAGGG - Intergenic
1160369966 18:78363745-78363767 GACGGCACGCCTGCTGCGCACGG + Intergenic
1160918897 19:1510665-1510687 GACGCCACGCCCGCAGGAGCTGG + Exonic
1161067770 19:2247099-2247121 GACCCCAAGCCCGATGGGAGGGG - Intronic
1162811078 19:13164577-13164599 GACTCCACGGCCCCTTGGAAGGG + Intergenic
1162909625 19:13842176-13842198 GACGTGTCGCCCGCTGGGTAGGG - Intergenic
1163501757 19:17680337-17680359 GACCCGAAGCCCGCTGGGGAAGG - Intronic
1164527820 19:29024741-29024763 CACCCCACGCCAGCTGGGAATGG + Intergenic
1166268881 19:41701472-41701494 GACTCAACCCCCACTGGGAAAGG + Intronic
934901777 2:98165553-98165575 GAGGTCAGGCCGGCTGGGAAAGG + Intronic
937254407 2:120544873-120544895 GACCCCACGCTCGTTGAGAAAGG + Intergenic
946650869 2:221891909-221891931 GCCGCCACCCCGTCTGGGAAGGG + Intergenic
1179572209 21:42284456-42284478 GATGCCAAGCCCTCTGGGACAGG + Intronic
1179968404 21:44819413-44819435 GGCGCCACGTCCCCTCGGAAGGG - Intergenic
1182278118 22:29203017-29203039 GAGGCCCCGCCCGCAGGGACAGG + Intergenic
1185285370 22:49997540-49997562 GGCGCCAGGCCCACTGGGGAAGG - Intronic
956026868 3:64992602-64992624 GGAGCTACGCCTGCTGGGAAAGG - Intergenic
959909473 3:111747649-111747671 GAAGCCTCTCCCGCAGGGAAGGG + Intronic
969043822 4:4322127-4322149 GCTGTCAAGCCCGCTGGGAAGGG - Intergenic
978238819 4:106491848-106491870 GAAGCCAAGCCAACTGGGAATGG - Intergenic
981970330 4:150659131-150659153 GCCGCCACCCCGTCTGGGAAGGG + Intronic
985345687 4:189002077-189002099 CACGCCCCTCCCGCTGGGCACGG + Intergenic
985494488 5:196768-196790 GTCCCCACCCCCGCTGTGAAGGG + Intergenic
985624521 5:978108-978130 GTGGCCACGGACGCTGGGAAGGG - Intergenic
999188577 5:149730630-149730652 GGCGCTACGGCCGCTGGGGAGGG + Intronic
1001773069 5:174310167-174310189 GACCCCATGCCTGCTGGGCATGG - Intergenic
1007673525 6:43576155-43576177 GACAGCGCGCCCGCTGCGAAGGG - Exonic
1012908891 6:105097445-105097467 GACGCCACGCCCGCTGGGAAGGG + Exonic
1018125536 6:160679160-160679182 CAGGCCAAGGCCGCTGGGAAAGG - Intergenic
1018150304 6:160931237-160931259 CAGGCCAAGGCCGCTGGGAAAGG + Intergenic
1018746174 6:166764136-166764158 GACTCCACTCCCACTGGGGAGGG + Intronic
1019642610 7:2112433-2112455 AACGCCACTTCCACTGGGAACGG + Intronic
1022083193 7:27044495-27044517 GCCGCCACCCCGTCTGGGAAGGG + Intergenic
1026777266 7:73238439-73238461 GAAGCCACGCCCACAGGGAAGGG + Intergenic
1027018114 7:74791808-74791830 GAAGCCACGCCCACAGGGAAGGG + Intergenic
1027069913 7:75154104-75154126 GAAGCCACGCCCACAGGGAAGGG - Intergenic
1032260417 7:130331628-130331650 GACCCCAGGCCCGGTGGGAAAGG + Intergenic
1035645264 8:1214093-1214115 GACGCAAGGCCCCCTGGGGAGGG - Intergenic
1036737118 8:11329728-11329750 GCCGCCACCCCGTCTGGGAAGGG + Intergenic
1041095480 8:54344787-54344809 GATGCCGCTCCCCCTGGGAACGG + Intergenic
1053445840 9:38152601-38152623 GACCCCACCACTGCTGGGAACGG - Intergenic
1057034327 9:91800731-91800753 CACGTGAAGCCCGCTGGGAATGG - Intronic
1062037508 9:134389337-134389359 GAGGCCAAGCAGGCTGGGAAGGG + Intronic
1189571893 X:42306888-42306910 GAAGCCCCGCCCACTGAGAAAGG - Intergenic
1200102892 X:153696824-153696846 GCAGCCACACCCGCGGGGAAGGG + Intergenic