ID: 1012924915

View in Genome Browser
Species Human (GRCh38)
Location 6:105258080-105258102
Sequence GACACTGAGGTCTAGACAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012924912_1012924915 -6 Left 1012924912 6:105258063-105258085 CCTTATTTTATAGATGTGACACT No data
Right 1012924915 6:105258080-105258102 GACACTGAGGTCTAGACAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012924915 Original CRISPR GACACTGAGGTCTAGACAGG TGG Intergenic
No off target data available for this crispr