ID: 1012930136

View in Genome Browser
Species Human (GRCh38)
Location 6:105307997-105308019
Sequence TCACCATCTTTAGCATCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012930134_1012930136 13 Left 1012930134 6:105307961-105307983 CCTTTTTATTTAAATTAGGATTA 0: 1
1: 0
2: 4
3: 65
4: 704
Right 1012930136 6:105307997-105308019 TCACCATCTTTAGCATCCTTTGG 0: 1
1: 0
2: 0
3: 13
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012930136 Original CRISPR TCACCATCTTTAGCATCCTT TGG Intronic
901266676 1:7915750-7915772 TGGAAATCTTTAGCATCCTTCGG + Intergenic
902641241 1:17767654-17767676 TCACCATGTTTATCCTCCATAGG + Intronic
905623609 1:39471028-39471050 TAACCTTTTTTAGCATCCCTTGG + Intronic
907942947 1:59106689-59106711 CCAGCATCATCAGCATCCTTTGG + Intergenic
913042000 1:115036099-115036121 TGGCCATCTTTGGCATCCCTTGG + Intergenic
913352688 1:117879460-117879482 TCATCATCATTATCATTCTTAGG - Intronic
914349289 1:146826463-146826485 TCACCACCTTGATCTTCCTTGGG - Intergenic
914877088 1:151520239-151520261 CCACCATCTATGGCATCCTGAGG + Exonic
915575074 1:156770336-156770358 TGACCATCTTGAACATTCTTAGG - Intronic
916357719 1:163931756-163931778 CCATCCTCTCTAGCATCCTTAGG - Intergenic
917793683 1:178516295-178516317 CAACCACCTGTAGCATCCTTAGG + Intronic
919251653 1:195064458-195064480 TGGCCATCTTTAGCATTCCTTGG - Intergenic
919870961 1:201820960-201820982 CCACTATCTTTGGCATCCATGGG + Exonic
921068823 1:211642466-211642488 GCCCCATCTTTGGCTTCCTTGGG + Intergenic
921776660 1:219108736-219108758 TCACTATTTTTTGCATTCTTTGG + Intergenic
923132812 1:231092138-231092160 CCACCCTCTTTAGCATTCTGAGG - Intergenic
1063595625 10:7432649-7432671 TCTCCCTATTTTGCATCCTTGGG + Intergenic
1071786980 10:88912135-88912157 TCACCAGCATTAGCATCATTTGG + Intronic
1074339913 10:112618371-112618393 TCATCATCATCATCATCCTTAGG + Intronic
1076326742 10:129629605-129629627 TGATCATCTTTAGGATCTTTAGG + Intronic
1078413836 11:11149234-11149256 GCATCATCTCTAGCTTCCTTAGG - Intergenic
1078511439 11:11987227-11987249 TCACCATCTTTCTCAGCATTAGG + Intronic
1078761260 11:14253665-14253687 TCCCCATGATTAGCAGCCTTGGG + Intronic
1078825522 11:14926444-14926466 CCAGCATCTTTGGCATCCCTTGG - Intronic
1078829489 11:14965927-14965949 TCAACAACCATAGCATCCTTTGG - Intronic
1080767231 11:35308078-35308100 TAGGCTTCTTTAGCATCCTTAGG - Intronic
1081015029 11:37866369-37866391 TCACTCTCTTTTGAATCCTTAGG + Intergenic
1082083635 11:48031457-48031479 TCATCATCTGTATCATGCTTTGG - Intronic
1085349358 11:75788634-75788656 TCACCATGTTGAGCCTCCTTTGG - Intronic
1086402492 11:86472212-86472234 TCCCCATCTTCAGCCTCCTCTGG - Intronic
1087689826 11:101307376-101307398 TTATCATCTTCAGCATTCTTTGG + Intergenic
1088895966 11:114078656-114078678 TCACTATCTTTAGCATCTCTTGG - Intronic
1089917292 11:122170405-122170427 CCACCATCTTCAGAATTCTTTGG + Intergenic
1090339107 11:125999787-125999809 TCTCCTTCTCTAACATCCTTTGG + Intronic
1094083595 12:26564705-26564727 TGACAATCTTTGGCATTCTTTGG - Intronic
1094707873 12:32932328-32932350 ACACTACCTTTAGCATCCTGAGG - Intergenic
1100141805 12:91628005-91628027 TCTCCATCTTTACCAGCATTTGG + Intergenic
1100192719 12:92209818-92209840 TCACTATCTGTATCATCCTCAGG + Intergenic
1101318407 12:103650680-103650702 TCACCATCCTTATCATCAGTAGG - Intronic
1105913498 13:24892387-24892409 TCACCGTCTTCAGCATGTTTAGG + Intronic
1106285747 13:28316933-28316955 ACAACTTCTTTAGAATCCTTTGG - Intronic
1107310804 13:39075068-39075090 TTACCCTCTTTAGCAACATTGGG - Intergenic
1110453090 13:75659075-75659097 TCAGCATCTTTAGCATTATGTGG + Intronic
1114369942 14:22075724-22075746 TGGCAATCTTTAGCATTCTTTGG - Intergenic
1114544007 14:23485101-23485123 TTAGCTGCTTTAGCATCCTTTGG + Intronic
1116330397 14:43589506-43589528 TTACCATCTTTATCATCTTCAGG - Intergenic
1118348816 14:64959147-64959169 TCAGCATGTTCATCATCCTTAGG - Intronic
1118506605 14:66420283-66420305 TTACCATCTTTAGGAACCTAGGG - Intergenic
1119860628 14:77933514-77933536 TCACCATCCTTCTCCTCCTTTGG + Exonic
1120002408 14:79317328-79317350 TGACAATCTTTGGCATTCTTTGG + Intronic
1125177120 15:36836962-36836984 TGACAATCTTTAGCATTCCTTGG + Intergenic
1126568968 15:50129416-50129438 TGACAATCTTTGGCATTCTTTGG + Intronic
1126879966 15:53083955-53083977 TGACCATTTTTAGAATTCTTAGG - Intergenic
1126987393 15:54328490-54328512 TCACCTTCTTTAGCACCCCTGGG - Intronic
1127693798 15:61424011-61424033 TCACTAGTTTTAGCATCCATTGG + Intergenic
1131360993 15:91790479-91790501 TCTCCCTCTTCAGCCTCCTTGGG + Intergenic
1133292283 16:4730327-4730349 TCACCAGATTTAGCATGGTTGGG - Intronic
1133930407 16:10227709-10227731 TAATCATCTTAAGCATCCTTAGG + Intergenic
1137712448 16:50575793-50575815 CCACCATTTGTTGCATCCTTTGG + Intronic
1137714525 16:50590387-50590409 TAAACATCTTTAGCATTCGTTGG - Intronic
1137743582 16:50804344-50804366 TCCCCAACTTTAGCAGACTTTGG + Intergenic
1139046804 16:63070655-63070677 TTACCATCTTTATAATCTTTAGG + Intergenic
1139984747 16:70889091-70889113 TCACCACCTTGATCTTCCTTGGG + Intronic
1140635403 16:76907252-76907274 TCACCATGTTTAGTAGCCTGTGG + Intergenic
1141334839 16:83144961-83144983 TCACCCTTCTTAGCATCCTGGGG + Intronic
1143011811 17:3870109-3870131 TCACCATCTTTGCCACCCATTGG - Intronic
1144479838 17:15619983-15620005 TAAACATATTTAGCATCATTGGG - Intronic
1144918464 17:18743753-18743775 TAAACATATTTAGCATCATTGGG + Intergenic
1147495808 17:40914073-40914095 TCAGCAGCCTTAGCATCCTCTGG + Intergenic
1149280524 17:55100186-55100208 ACACCCTCTTTAGTATCTTTTGG - Intronic
1150599209 17:66636046-66636068 CCTCCATCCTCAGCATCCTTAGG + Intronic
1150936876 17:69645477-69645499 TCACCAAATTTAGCATTCATTGG + Intergenic
1154053345 18:10984740-10984762 TCAACCTCTTTAGAATCCTTTGG - Intronic
1160261870 18:77301617-77301639 TCACCATCGATGGGATCCTTCGG + Intergenic
1162710663 19:12591738-12591760 TCTCCATCTTCACCATCATTTGG - Intronic
1163739384 19:19001530-19001552 TCACAAGCTGCAGCATCCTTTGG + Intronic
1164548021 19:29185202-29185224 TCACCAGCTTTAGCCTCTCTGGG - Intergenic
1166362617 19:42260562-42260584 TCACCATCTCTACCATCTCTGGG - Intergenic
927955044 2:27202045-27202067 TCAGCATCTTTGGCATGGTTGGG - Exonic
928258484 2:29745599-29745621 ACACAATCTTTTTCATCCTTTGG + Intronic
930924574 2:56801285-56801307 TCATCAGATTTAGCATTCTTTGG + Intergenic
931856758 2:66310044-66310066 TCACCAATTTTAGCATGCATGGG + Intergenic
932291750 2:70586711-70586733 TTACCATCTTTACCATTTTTAGG + Intergenic
933711083 2:85326743-85326765 TCATCATCTTCAGCCTCTTTGGG + Exonic
935511205 2:103976833-103976855 TCAGCATCAACAGCATCCTTGGG + Intergenic
936226594 2:110659766-110659788 TCATCTTCTTTAACATTCTTTGG - Intronic
936790775 2:116148973-116148995 TCACAACCTTTAGGATCTTTAGG - Intergenic
940179347 2:150914578-150914600 TGAGAATCTTTGGCATCCTTTGG + Intergenic
941752633 2:169149284-169149306 TTATCATCTTCATCATCCTTTGG + Intronic
942962517 2:181849092-181849114 TCACCATTTTTAGCTCCTTTTGG + Intergenic
943770248 2:191708751-191708773 TTTACATCCTTAGCATCCTTAGG + Intergenic
944179553 2:196874444-196874466 CCACTATTTTTAGCATCCATTGG - Intronic
1168759273 20:337930-337952 TTACCATCTTAACCATCTTTAGG + Intergenic
1168974517 20:1954110-1954132 CCAGCATCTTCAGCATCCTCTGG + Intergenic
1169612992 20:7404187-7404209 TCATCAGCTTTAGCCTTCTTAGG - Intergenic
1170027140 20:11901313-11901335 TCACCATCTTTTGTGGCCTTGGG + Intronic
1171421625 20:25021376-25021398 TCACCATCCTTACCAGCATTGGG + Exonic
1173011361 20:39185911-39185933 TCCCCTTCAGTAGCATCCTTGGG + Intergenic
1183749165 22:39709784-39709806 TGACCATCATTAGCATACCTGGG + Intergenic
1184376580 22:44117318-44117340 TCACCCTCTACAGCCTCCTTTGG - Intronic
949912144 3:8920447-8920469 CCCCTATATTTAGCATCCTTTGG - Intronic
952179191 3:30900171-30900193 TTACAATCTTTTGCATACTTTGG + Intergenic
952816914 3:37453634-37453656 TCACCAGCCTGAGCGTCCTTAGG + Intronic
954391795 3:50271409-50271431 TTACCATCTTTCGCAGCCTAGGG + Exonic
956990783 3:74761447-74761469 TCTCCATATTTTCCATCCTTTGG - Intergenic
957443288 3:80281207-80281229 TCCACATCTTTGTCATCCTTTGG + Intergenic
957615768 3:82524787-82524809 TTACCATCTATAGCATTTTTAGG + Intergenic
961771701 3:129254795-129254817 GCATCATCTTTTGCATTCTTTGG + Intronic
964066687 3:152588370-152588392 TCACCATCTTTAATGTCCTAGGG - Intergenic
965339338 3:167467375-167467397 TCACCGTTTTTTGCACCCTTAGG + Intronic
969343059 4:6554311-6554333 TGTCCATCTTTGGCATTCTTTGG - Intronic
973563928 4:52164678-52164700 TTACCACCTTTAACCTCCTTTGG - Intergenic
973576688 4:52296822-52296844 CCAGCATCTTCAGCATCCTCTGG - Intergenic
974178304 4:58353442-58353464 TTCCCATCTTTAGCTTCCTTAGG - Intergenic
974672110 4:65045592-65045614 TCACTATCTGTAGCAATCTTTGG + Intergenic
975235099 4:71985270-71985292 TCAGCATCTTTACCATGCTAGGG - Intergenic
977748124 4:100576173-100576195 TCTTCATCTTTAAAATCCTTTGG - Intronic
981236038 4:142416664-142416686 TCTCCATCTAGATCATCCTTTGG + Intronic
985527518 5:414563-414585 TCACCATCTATGGCTTCCTTGGG - Intronic
986144867 5:5068040-5068062 TCACCTTCTTTTGCATCTATGGG - Intergenic
986308455 5:6532900-6532922 TCACCACCTTCTGCATCCTGGGG + Intergenic
986841710 5:11705235-11705257 ACACAATGTGTAGCATCCTTTGG - Intronic
988734392 5:34006516-34006538 TCACTATCTTTACCTTCCTAAGG + Intronic
988848915 5:35159228-35159250 TGACAATTTTTGGCATCCTTCGG + Intronic
991668033 5:69019532-69019554 TGACCATTTTTGGCATTCTTTGG + Intergenic
993180135 5:84542094-84542116 TCCCCTTTCTTAGCATCCTTGGG + Intergenic
993445607 5:88008662-88008684 TCTTAATCTTTAGCATTCTTTGG + Intergenic
995879275 5:116825857-116825879 ACTTCATCTTTAGCATCCTATGG + Intergenic
998340850 5:141416347-141416369 TCACCCTCTATAGCCTCCTCAGG - Intronic
999379360 5:151109543-151109565 TCACCTTCTTTCTCCTCCTTAGG - Intronic
1000420712 5:161035166-161035188 TCACCATATTTATAATCCTGAGG - Intergenic
1000664293 5:163975667-163975689 TCTTCATCTTTATCATCTTTAGG - Intergenic
1002008673 5:176258393-176258415 TCTCCATCTTTAAGATCCTGGGG + Intronic
1002218049 5:177653858-177653880 TCTCCATCTTTAAGATCCTGGGG - Intergenic
1002375647 5:178787183-178787205 TCACCAACTTTAGGAAGCTTTGG - Intergenic
1008482796 6:52004460-52004482 TCAACATCTCTATCATCCATAGG + Intronic
1012171704 6:96024501-96024523 GCACCATCTATTTCATCCTTGGG + Intronic
1012327497 6:97940456-97940478 TGACCATCTTTGGCAACCTGAGG - Intergenic
1012930136 6:105307997-105308019 TCACCATCTTTAGCATCCTTTGG + Intronic
1013548756 6:111186575-111186597 TCAACATCTAGGGCATCCTTTGG + Intronic
1013732745 6:113188109-113188131 TCACCATCTTTGACATCCTATGG + Intergenic
1013806450 6:114001275-114001297 TCACCAGCCATAGCATTCTTAGG + Intronic
1015344841 6:132144259-132144281 TCATCATCATTATCATTCTTAGG - Intergenic
1015502217 6:133946223-133946245 TGGCAATCTTTGGCATCCTTGGG - Intergenic
1015912073 6:138179010-138179032 TTTGTATCTTTAGCATCCTTTGG - Intronic
1016133469 6:140507302-140507324 TCCCCAACTTCAGCTTCCTTTGG + Intergenic
1016829177 6:148416776-148416798 TTACCATTCTTAGCAACCTTGGG + Intronic
1017345359 6:153373239-153373261 TCACCATCTTCAGCTCACTTAGG + Intergenic
1019211867 6:170413216-170413238 GTCCCATCCTTAGCATCCTTGGG + Intergenic
1020656497 7:10934523-10934545 ACAACCTCTTTAGCATTCTTTGG - Intronic
1020698753 7:11449812-11449834 TCAATTTTTTTAGCATCCTTGGG - Intronic
1022521022 7:31006896-31006918 TCACCTTCTTCAGCATCCCCTGG - Intergenic
1022671181 7:32457777-32457799 TCACCACCTTGAGCATCCCCTGG - Intergenic
1024544891 7:50508827-50508849 TCTCCAGCTTTACAATCCTTTGG + Intronic
1026528745 7:71178838-71178860 TCAACATCTGGATCATCCTTGGG + Intronic
1026951959 7:74353716-74353738 TCTCCATCTCAATCATCCTTAGG + Intronic
1029810179 7:103039051-103039073 TCAAGATTTTTAGCTTCCTTGGG - Intronic
1029941532 7:104485503-104485525 TTATCATCTTTATCATCCTTTGG + Intronic
1030200741 7:106901093-106901115 TCAGCTTCTTTAGCAAGCTTGGG + Intronic
1030220399 7:107092735-107092757 TCACGATTTTTACCATTCTTAGG + Intronic
1031150204 7:118045434-118045456 ACACCATCTTTAACATCCTGAGG - Intergenic
1032715378 7:134504904-134504926 TTCCCATCTTTAGAATCCTTGGG + Intergenic
1034381869 7:150703273-150703295 TCACTTTATTTAGTATCCTTTGG - Intergenic
1034860346 7:154589766-154589788 TCCACATCTTTAGCCTTCTTTGG + Intronic
1035948304 8:3990379-3990401 TCTCCATCCTTACCATTCTTAGG - Intronic
1037246865 8:16845229-16845251 TCATCTTGTTTAGAATCCTTCGG - Intergenic
1037434056 8:18844274-18844296 TCACCATCTTTAGAATTCTCAGG - Intronic
1037615111 8:20512145-20512167 TCACCATCTGTGGCATTGTTTGG - Intergenic
1037752030 8:21688907-21688929 TGACCAGCCTCAGCATCCTTGGG + Intergenic
1041139173 8:54796629-54796651 TGTCAATCTTTGGCATCCTTTGG - Intergenic
1041789474 8:61676888-61676910 TTACCATTTATAGCATCCATAGG + Intronic
1042415971 8:68519144-68519166 TCAGATTCTTTAGCTTCCTTTGG + Intronic
1042736957 8:72000361-72000383 TCACCATAATTAGCACGCTTAGG + Intronic
1043800438 8:84603068-84603090 TTACCATCTTTATCATTTTTAGG - Intronic
1046683723 8:117201079-117201101 CCACCATCTTTAGTAGCCCTGGG - Intergenic
1051033280 9:12709786-12709808 TCACCATCTTTGTCAAACTTTGG + Exonic
1051908909 9:22130067-22130089 TTACTATCTAAAGCATCCTTTGG - Intergenic
1052812300 9:33072436-33072458 TTCCCATCTTTAGCTTTCTTTGG - Intronic
1055225943 9:73995558-73995580 TCACCATCTTAAAAATCCCTAGG + Intergenic
1058234515 9:102472940-102472962 TCAGCATCACTAGCCTCCTTTGG - Intergenic
1059665964 9:116446949-116446971 ACATCATCTTCATCATCCTTAGG + Intronic
1061136104 9:128734677-128734699 TCACCATCTTTAGGAGCCACTGG - Intronic
1185967153 X:4619533-4619555 TCATCATCATCATCATCCTTGGG + Intergenic
1189147069 X:38666291-38666313 TCACCAGTTTCAGCATCCATGGG - Exonic
1191248771 X:58248753-58248775 TCTCCATCTTTAGAATGCCTGGG - Intergenic
1193917958 X:87389150-87389172 TAGCCATCTTTGGCATCATTAGG + Intergenic
1196034100 X:111124245-111124267 TTTCCATCTTTTCCATCCTTGGG - Intronic
1196610714 X:117711546-117711568 AAACCATCCATAGCATCCTTAGG - Intergenic
1198042943 X:132872373-132872395 TCACCAGCTTTAACATTCTGAGG - Intronic
1199265593 X:145822410-145822432 TCAGCATCTTTAGGCACCTTCGG - Exonic
1202179853 Y:22130430-22130452 TGAAGATCTTTTGCATCCTTAGG + Intergenic
1202211508 Y:22455964-22455986 TGAAGATCTTTTGCATCCTTAGG - Intergenic