ID: 1012931422

View in Genome Browser
Species Human (GRCh38)
Location 6:105321452-105321474
Sequence CGGTTTAACCTGGACATTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012931417_1012931422 6 Left 1012931417 6:105321423-105321445 CCTGGCAGCGCCGAAGCGCATGT 0: 1
1: 0
2: 0
3: 2
4: 40
Right 1012931422 6:105321452-105321474 CGGTTTAACCTGGACATTCCAGG No data
1012931415_1012931422 21 Left 1012931415 6:105321408-105321430 CCAGTGCCACAGGCACCTGGCAG 0: 1
1: 0
2: 2
3: 45
4: 368
Right 1012931422 6:105321452-105321474 CGGTTTAACCTGGACATTCCAGG No data
1012931419_1012931422 -4 Left 1012931419 6:105321433-105321455 CCGAAGCGCATGTTCTCCACGGT 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1012931422 6:105321452-105321474 CGGTTTAACCTGGACATTCCAGG No data
1012931416_1012931422 15 Left 1012931416 6:105321414-105321436 CCACAGGCACCTGGCAGCGCCGA 0: 1
1: 0
2: 0
3: 9
4: 135
Right 1012931422 6:105321452-105321474 CGGTTTAACCTGGACATTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012931422 Original CRISPR CGGTTTAACCTGGACATTCC AGG Intronic
No off target data available for this crispr