ID: 1012931957

View in Genome Browser
Species Human (GRCh38)
Location 6:105326785-105326807
Sequence CAGAGAAAAGAGAAAAATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1788
Summary {0: 1, 1: 0, 2: 14, 3: 162, 4: 1611}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012931954_1012931957 12 Left 1012931954 6:105326750-105326772 CCATTCTCTGGTTTTAGAAATCA 0: 1
1: 0
2: 5
3: 33
4: 382
Right 1012931957 6:105326785-105326807 CAGAGAAAAGAGAAAAATGGAGG 0: 1
1: 0
2: 14
3: 162
4: 1611
1012931953_1012931957 13 Left 1012931953 6:105326749-105326771 CCCATTCTCTGGTTTTAGAAATC 0: 1
1: 0
2: 1
3: 25
4: 287
Right 1012931957 6:105326785-105326807 CAGAGAAAAGAGAAAAATGGAGG 0: 1
1: 0
2: 14
3: 162
4: 1611
1012931951_1012931957 21 Left 1012931951 6:105326741-105326763 CCGGAAGCCCCATTCTCTGGTTT 0: 1
1: 0
2: 5
3: 22
4: 210
Right 1012931957 6:105326785-105326807 CAGAGAAAAGAGAAAAATGGAGG 0: 1
1: 0
2: 14
3: 162
4: 1611
1012931952_1012931957 14 Left 1012931952 6:105326748-105326770 CCCCATTCTCTGGTTTTAGAAAT 0: 1
1: 0
2: 5
3: 41
4: 401
Right 1012931957 6:105326785-105326807 CAGAGAAAAGAGAAAAATGGAGG 0: 1
1: 0
2: 14
3: 162
4: 1611

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012931957 Original CRISPR CAGAGAAAAGAGAAAAATGG AGG Intronic
900161424 1:1225815-1225837 CAGAGCAAAAAGCAAAAAGGTGG + Intronic
900306047 1:2008824-2008846 CAAAGAAAAAAAAAAAATGCTGG + Intergenic
900932879 1:5747793-5747815 GAGAGAAAGGAGAAAGAGGGAGG + Intergenic
901115717 1:6842126-6842148 CAAAGTAAAGAAAGAAATGGAGG - Intronic
901260905 1:7869865-7869887 CAGTGATATGAGAAAAATGCTGG - Intergenic
901575608 1:10198424-10198446 CTCAGAAAAAAGAAAAAAGGAGG - Intergenic
901598208 1:10401629-10401651 CAGAGAAAACTGAAAAATGGTGG + Intronic
901905945 1:12411313-12411335 CAGAGAAAAGAAAAATTTGGAGG + Intronic
902129100 1:14243208-14243230 CAAAGAAAAGAGAAAGATGCTGG - Intergenic
902218690 1:14950792-14950814 CAGGGAAAAGATGGAAATGGGGG + Intronic
902224013 1:14985135-14985157 CAAAAAAAAAAAAAAAATGGTGG + Intronic
902884537 1:19395363-19395385 CTGAGAAAAGAAAGAGATGGAGG - Intronic
903334374 1:22615131-22615153 AAGAGAAAAAAGAAATCTGGAGG - Intergenic
903835644 1:26201651-26201673 AAGAAAAAAGAAAAAAAAGGAGG - Intronic
904110576 1:28122946-28122968 CATAAAAAAGAAAAAATTGGTGG - Intergenic
904230984 1:29072009-29072031 CAGAGACAAGAGAACAATATTGG - Intronic
904761534 1:32808216-32808238 CAAAAAAAAAAAAAAAATGGTGG - Intronic
904989262 1:34578389-34578411 CAGAGTAAAGGGACAAAGGGTGG - Intergenic
905004111 1:34696512-34696534 AAGAGATTAGAAAAAAATGGAGG - Intergenic
905069914 1:35216579-35216601 AAGAGAAAAGAGAAAGAGGCGGG - Intergenic
905118912 1:35666708-35666730 GAGAACAGAGAGAAAAATGGAGG - Intergenic
905592489 1:39176558-39176580 CAGAAAAATGACTAAAATGGGGG - Intronic
906679838 1:47718759-47718781 CAAAGAAAAGAGAGAAAGTGTGG + Intergenic
906983677 1:50659293-50659315 AAGAGAAGAGAGGAAGATGGAGG + Intronic
907241460 1:53083563-53083585 CAGAGAAAACGGAAGACTGGAGG - Intronic
907325271 1:53633922-53633944 CAGTGAACAGAGAATCATGGCGG + Intronic
907376483 1:54047608-54047630 CAAAGAAAATGGAAAAAGGGTGG - Intronic
907492845 1:54819923-54819945 CAGAAAGAAAAGAAATATGGGGG - Intronic
907590204 1:55659458-55659480 CAGAGAAAACAAAAAAAAGTAGG - Intergenic
907591754 1:55680546-55680568 CAGTGAAAAGACAAAAAAGTAGG - Intergenic
907741788 1:57173239-57173261 CAGATGAGGGAGAAAAATGGAGG + Intronic
907771482 1:57469397-57469419 CAGAAAAAGGAGAAAAAAGTTGG + Intronic
907774505 1:57500207-57500229 CAGAGAAATGAGAAAAAAAGAGG + Intronic
908054780 1:60273090-60273112 AGGTGAAAATAGAAAAATGGAGG - Intergenic
908098523 1:60766147-60766169 CACAAAAATGAGAAAAATAGAGG + Intergenic
908337118 1:63137966-63137988 AAGAAAAAAGAAAAAATTGGGGG - Intergenic
908378181 1:63567506-63567528 TAGAGAACAGAGAACAGTGGGGG + Intronic
908671708 1:66555352-66555374 CAGATATAAGATAAAGATGGTGG - Intronic
908832833 1:68197843-68197865 AAGAGAAAAGAGCTAAATGGAGG + Intronic
908849764 1:68363871-68363893 AAGGGAAAAGAGAAAATAGGAGG + Intergenic
908889364 1:68826087-68826109 CAGACAAGAGAGAAAATGGGAGG + Intergenic
909048719 1:70742453-70742475 CAGTGAAAAAAGAAAAATTCAGG - Intergenic
909184679 1:72471329-72471351 GAGAAAAAAAAGAGAAATGGAGG + Intergenic
909813476 1:79960378-79960400 AAGAGAAAACAGTAAAATGAGGG - Intergenic
909885524 1:80937928-80937950 CAGAAAAAAGAGACATATAGAGG + Intergenic
910163335 1:84297911-84297933 CAGAGAAAAGCTAAAGATGCAGG - Intergenic
910462153 1:87459106-87459128 CAGAGGAAAGAGAAAAATTGAGG + Intergenic
910548962 1:88454464-88454486 CAGAGAAAAGAGAGTATTAGAGG - Intergenic
910606600 1:89092104-89092126 CAGAGGAAAAAGAAAATTGGAGG + Intergenic
910782342 1:90953293-90953315 CAAAAAAAAAAAAAAAATGGTGG - Intronic
910826992 1:91419920-91419942 CAGAAAAAAAAAAAAAAAGGCGG - Intergenic
910855519 1:91691210-91691232 GAGAGAAAACAGAAAAAAGGGGG + Intronic
910922173 1:92359889-92359911 CAGAGAAAGCAGAAAAGGGGAGG + Intronic
911062075 1:93757333-93757355 CAGAGAAAAGAGAAAATGGGGGG - Intronic
911245777 1:95515459-95515481 TAGAAAAAGGAGTAAAATGGTGG - Intergenic
911389271 1:97218532-97218554 AACAGAAAAGAGGAAAAGGGAGG - Intronic
911412656 1:97529652-97529674 AAGAGAAAAGAAAAAAAGGAAGG - Intronic
911559915 1:99392298-99392320 CAGAGAAAAGATAAAATTACAGG + Intergenic
911602520 1:99862252-99862274 CTTAGAAATGAGAAAAGTGGTGG + Exonic
911903945 1:103541419-103541441 GAGAAAAAAGAGAAAAATAAAGG + Exonic
911957511 1:104256346-104256368 GAGAGAAAAGGGAAGAATGAAGG - Intergenic
912180247 1:107210376-107210398 CGGAGAACAGAGTAAAATGGTGG + Intronic
912245332 1:107956185-107956207 GAGAGAAAAGACAAAATTGGAGG - Intronic
912425702 1:109587967-109587989 CAGAGAGGAGAGAAAAAAGATGG - Intronic
912507911 1:110168950-110168972 CAGAGAAGATAGAAAAAGGAAGG - Intronic
912754870 1:112316081-112316103 CAGAGAGAAGAGACAAAAAGAGG + Intergenic
912758724 1:112346947-112346969 CAGAGAAAAGGGAAAAAGACTGG + Intergenic
912818966 1:112851643-112851665 CAGATAAAAATAAAAAATGGTGG + Intergenic
912863499 1:113236367-113236389 CAGAGAAAATAGTACAATGAAGG - Intergenic
912902049 1:113661724-113661746 CAGAGAAAAGAGAAGGGTGGAGG + Intronic
913088835 1:115462367-115462389 GAGAGAAGAAAGAATAATGGTGG - Intergenic
913453700 1:119009395-119009417 TAGAGAAAGGAGAAAGATGAAGG + Intergenic
913547897 1:119887563-119887585 CTGGGAGAAGGGAAAAATGGTGG + Intergenic
913708911 1:121460132-121460154 AGGATAGAAGAGAAAAATGGTGG - Intergenic
913941528 1:125112855-125112877 TAGAGAACAGAGAAAAAAGTAGG + Intergenic
914312986 1:146484231-146484253 CAAAGAAAAGAGGAAAGGGGAGG + Intergenic
914687933 1:149998532-149998554 TAGAGAAGAGAGAAATATAGCGG - Intronic
914754501 1:150554986-150555008 CAGAAAAAAAAAAAAAAAGGTGG - Intronic
914820301 1:151096904-151096926 AAAAGAAAAAAGAAAAATGAGGG - Intronic
915007797 1:152656146-152656168 CAGAGAAATGAACAAGATGGAGG + Intergenic
915987868 1:160484360-160484382 CAAAGAAAAGAGTAAAAAGAGGG - Intergenic
916150725 1:161786399-161786421 AAGAGACAAAAGAAAAATTGGGG - Intronic
916208473 1:162338331-162338353 AGGAGAAAAGAGAATAATGGGGG - Intronic
916312746 1:163415102-163415124 AAGAGAAAAGGGAGAATTGGTGG - Intergenic
916393711 1:164361907-164361929 CAGAGAAGGTATAAAAATGGAGG - Intergenic
916458822 1:164999545-164999567 CAGATAAGAGAGAAAATAGGTGG - Intergenic
916684056 1:167128442-167128464 CAGAAAACAGAGAAGAAGGGAGG + Exonic
916750714 1:167721067-167721089 CTTACAAAAGGGAAAAATGGGGG - Intergenic
916779759 1:168012046-168012068 AAGAGAACAGAGAAACATGGAGG + Intronic
916960040 1:169880197-169880219 AAGAGAAAAGAAAAAAATTGGGG + Intronic
917004138 1:170394001-170394023 GAGAGAAGAGAGAAAAAGTGGGG - Intergenic
917040800 1:170804022-170804044 AAGAGAAAAGAGAACAATCATGG + Intergenic
917058945 1:171016137-171016159 CATATAAAAGGAAAAAATGGTGG - Intronic
917476790 1:175375628-175375650 CACAACAAAGAGGAAAATGGTGG + Intronic
917653975 1:177107470-177107492 CAGAGCAAGGAGAAAAAAAGTGG - Intronic
917659087 1:177160248-177160270 TGGAGAAAACAGAAGAATGGGGG - Intronic
917830587 1:178880569-178880591 TAGAGAGAAGGGAAAAATAGTGG - Intronic
917856917 1:179108580-179108602 AAGGGTAAAGAGAAGAATGGTGG - Exonic
917896669 1:179496669-179496691 CGTAGAAAACAGAAAAATTGTGG - Intronic
918018062 1:180657728-180657750 CTGAGCAAAAAGAAAACTGGAGG - Intronic
918206412 1:182313448-182313470 TATGGAAAAGAGAAAAAAGGAGG + Intergenic
918263854 1:182821862-182821884 CAGAAAAAAGATAAAAAAGATGG - Intronic
918390799 1:184059393-184059415 CAGAGAAAAGAGGGAAAGGATGG + Intronic
918430489 1:184454935-184454957 AAGAGAAAAGAGAAAGAAAGAGG + Intronic
918554707 1:185784497-185784519 AAAAAAAAAGAGAAAAGTGGGGG - Intronic
918675888 1:187285513-187285535 CAAAGAAAAGAGGAAAATTAAGG - Intergenic
918737794 1:188088137-188088159 CAGAAAAAGGGGAAAAATGTTGG - Intergenic
918748914 1:188245017-188245039 CAGAAATAAGTGAAAAAAGGAGG + Intergenic
918943563 1:191031363-191031385 CAGGCAAAAGAAAAAAATAGAGG + Intergenic
919075027 1:192803022-192803044 GACAGAAAACAGAAAATTGGTGG + Intergenic
919237750 1:194868216-194868238 CAGAGAAAAAAAAAAAAGGAAGG + Intergenic
919366455 1:196667736-196667758 AAAAGAAGAGAGAAAAATTGAGG - Intronic
919503708 1:198371074-198371096 AAGAGAGAAAAGAAAAAAGGAGG - Intergenic
919507000 1:198411610-198411632 CAAAGTAAGGAGTAAAATGGTGG - Intergenic
919552072 1:199003167-199003189 CAGACAAGAGAAAAAAATCGTGG - Intergenic
919611911 1:199755922-199755944 CATATAAAACAGAAAAAAGGGGG + Intergenic
919750827 1:201037057-201037079 AAGAGAAAAGAGGAGATTGGAGG + Intergenic
919943548 1:202304433-202304455 CTAACAAAAGAGAGAAATGGAGG - Intronic
920159010 1:203981077-203981099 CAGAAAAAAAAAAAAAATAGAGG - Intergenic
920828024 1:209440249-209440271 CAGAGAAAAGAAAAGACAGGAGG + Intergenic
921285896 1:213609056-213609078 CAGAGAAAAAATTGAAATGGAGG + Intergenic
921379921 1:214514047-214514069 GAGAGAAAAAAGGAAAATTGAGG - Intronic
921779096 1:219140292-219140314 CAGAGAAAAGGAATATATGGAGG + Intergenic
922150501 1:222999015-222999037 CTGAGAAAAGAACAAAAGGGAGG - Intronic
922433577 1:225581135-225581157 CAGAAAAAAAAGAAAAATGTGGG + Intronic
922481871 1:225944932-225944954 CAGAGAAGATAGCAAAGTGGAGG + Intergenic
922489800 1:226007003-226007025 AAGAGAAGAGAGCAAAATGGGGG + Intergenic
922642783 1:227251135-227251157 CAGAGAAAATACAAATATGTGGG + Intronic
923173022 1:231434458-231434480 TAAATAAAAAAGAAAAATGGTGG + Intergenic
923192024 1:231628298-231628320 AAAAGATAAAAGAAAAATGGGGG + Intronic
923297738 1:232611404-232611426 CTCAGAAGAGAGAAAAATGTGGG + Intergenic
923515073 1:234690282-234690304 GAGAGAAAAGAGAATAATGATGG + Intergenic
923566439 1:235079988-235080010 CAGAGGAAGGAGAAAATGGGAGG - Intergenic
923733658 1:236580268-236580290 CCGATAAAAGAGATAAATGCAGG + Intronic
923847706 1:237754934-237754956 CAGAGAAAAGAAAAAAAAAGAGG - Intronic
923935172 1:238751933-238751955 CAAAGGAAAAAGAAAAATGTAGG + Intergenic
924096471 1:240556578-240556600 AAAAGAAAAGAGAAATATTGAGG + Intronic
924162674 1:241249835-241249857 TTGAGAAGATAGAAAAATGGTGG + Intronic
924267598 1:242298876-242298898 AAGACAAAAGAGGAAAACGGTGG + Intronic
924673129 1:246148613-246148635 CAAAGAATGGAGGAAAATGGAGG + Intronic
924852260 1:247842212-247842234 CATACAAAAAAGAAAAATTGAGG + Intergenic
924891256 1:248283055-248283077 CACACAAAAGAGAAAAATTCAGG - Intergenic
1063201860 10:3791600-3791622 AAGAGAAAAGAAAAGAAAGGGGG + Intergenic
1063210025 10:3871974-3871996 CAGAGGAGAGAGAGGAATGGGGG - Intergenic
1063218751 10:3946951-3946973 AAAAGAAAAGAGAAAAAGGAAGG - Intergenic
1063312586 10:4968547-4968569 CATACAAAAGAGAGAAGTGGAGG + Intronic
1063315347 10:4999017-4999039 CATACAAAAGAGAGAAGTGGAGG - Intronic
1063337791 10:5233411-5233433 GAGATACAAGAGAAAAAAGGAGG - Intergenic
1063614386 10:7589624-7589646 GAGAGAACAGAGAATAGTGGAGG - Intronic
1063731971 10:8708228-8708250 CAGAGAAAAGGGAACACTGTTGG - Intergenic
1064050672 10:12056832-12056854 CAGAGAAGAGAGAAAGGAGGGGG - Intergenic
1064138237 10:12768704-12768726 CAGAAAAAAAAAAAAAATGCAGG + Intronic
1064232181 10:13538681-13538703 AAAAGAAAAAAGAAAAAAGGTGG + Intergenic
1064258128 10:13762724-13762746 AAAATAAAAGAAAAAAATGGTGG - Intronic
1064402611 10:15034097-15034119 AAAAGAAAAAAAAAAAATGGTGG - Intronic
1064493607 10:15885349-15885371 CAGAGATTTGAGAAAGATGGAGG - Intergenic
1064530900 10:16308630-16308652 AAGAGAAAAGTGAAAAGTGAGGG + Intergenic
1064973407 10:21089047-21089069 CAGAGGAGACAGAAAAAGGGAGG + Intronic
1065483918 10:26218128-26218150 CAGATAAAAGCGAGAAATGCGGG + Intronic
1065796922 10:29316232-29316254 GAGAGAAGGGAGAAAAATGAGGG - Intronic
1065891116 10:30122060-30122082 CGAAGAAAAGAGAGCAATGGGGG + Intergenic
1065945416 10:30601615-30601637 GAGAGAAAAGAGAAAACAAGAGG + Intergenic
1066132967 10:32412488-32412510 CATAGAAAAGGGAGAACTGGTGG + Intergenic
1066289114 10:33997888-33997910 CAAACAAAAAAGAAACATGGAGG + Intergenic
1066292871 10:34029795-34029817 CAGAGAAAACAGAAAATAGCAGG + Intergenic
1066386863 10:34948521-34948543 AAAAGAAAAAAGAAAGATGGAGG + Intergenic
1066717290 10:38299969-38299991 AAGACAAAAGAGGAAAACGGTGG - Intergenic
1066782238 10:38964398-38964420 TAGAGAACAGAGGAAAAAGGAGG + Intergenic
1066951166 10:42118692-42118714 TAGAGAACAGAGGAAAAAGGAGG - Intergenic
1066954879 10:42156229-42156251 TAGAGAACAGAGGAAAAAGGAGG - Intergenic
1067266516 10:44750077-44750099 CAGAGAAAGCAGAAAAATTGGGG - Intergenic
1068140814 10:53004795-53004817 AAGAGCAAAGAGAAAGTTGGGGG + Intergenic
1068459185 10:57304447-57304469 CATAGAAAAGAGAAAGATAGGGG + Intergenic
1068598180 10:58926690-58926712 CAGAAAAAAAAAAAAAATTGAGG + Intergenic
1068625379 10:59240663-59240685 CAAAGACAACAGAAATATGGAGG - Intronic
1068631905 10:59306882-59306904 CAAACAAAAAAGAATAATGGTGG + Intronic
1068692351 10:59930223-59930245 AAGAAGAAAGAGAAAAATGAAGG - Intergenic
1069163203 10:65115665-65115687 CAGAGAAACTAGAAAAATAGAGG - Intergenic
1069215938 10:65821380-65821402 CCATGAAAAGAGAAAAAAGGGGG - Intergenic
1069276463 10:66596594-66596616 AAGAGAAAAGAGAAATAGAGTGG + Intronic
1069468864 10:68668133-68668155 GAGAGAAAATAGATAAATGGAGG - Intronic
1069644512 10:69983336-69983358 CAAAAAAAAAAAAAAAATGGAGG + Intergenic
1069760092 10:70804124-70804146 AAGAGAAAAGGAAAGAATGGAGG + Intergenic
1069917067 10:71793707-71793729 AAGAGAAAGGAGAAAGAAGGGGG - Intronic
1070023536 10:72609733-72609755 CAAAAAAAAAAAAAAAATGGTGG + Intronic
1070171244 10:73934397-73934419 AAAAGAAAAGAAAAAAATGATGG - Intergenic
1070223510 10:74475800-74475822 AAGAGAAGAGAGAAAAAGGAGGG + Intronic
1070258605 10:74831524-74831546 CAGAGAACAGAAAAAAGTGAAGG - Intronic
1070469961 10:76768911-76768933 CAGAGAGAAGCCACAAATGGAGG - Intergenic
1070656496 10:78275273-78275295 CAGAGAGAAAAGAAAACAGGTGG + Intergenic
1070990980 10:80731989-80732011 AAGAAAAAAGAGAAAAAGAGAGG - Intergenic
1070991432 10:80736150-80736172 CAAGGAAAAAAGAGAAATGGAGG + Intergenic
1071029313 10:81156028-81156050 GAGAAAACAGACAAAAATGGTGG + Intergenic
1071036716 10:81256207-81256229 AAGAGAAAAGAAAGAAAGGGAGG - Intergenic
1071082771 10:81831990-81832012 GAGAGAAAAGATAAATTTGGAGG + Intergenic
1071204698 10:83260556-83260578 CAGAGATAAGAAAAAAAGGAGGG - Intergenic
1071366366 10:84904490-84904512 GAGAGAAAAGAGAAAAATGAAGG - Intergenic
1071497564 10:86179316-86179338 GAGAGCAAGGAGAAAGATGGAGG - Intronic
1072166022 10:92813865-92813887 AAAAGGAAAGAGAGAAATGGGGG - Intergenic
1072421622 10:95294592-95294614 GAGATAAAAAAGATAAATGGAGG - Intergenic
1072425719 10:95328750-95328772 CACCTAAGAGAGAAAAATGGTGG - Intronic
1073112684 10:101072018-101072040 CAGATAAAAGAGATGGATGGAGG - Intergenic
1073153802 10:101330472-101330494 GAGAGAAGAGAGACAAATGAGGG + Intergenic
1073228607 10:101946613-101946635 CGAAGAATAGAGACAAATGGGGG + Intronic
1073438379 10:103536158-103536180 CAGAGAACAGAAGAAAATGCTGG - Intronic
1073712250 10:106057029-106057051 GAAAGAAAAGAGAGAAAGGGAGG - Intergenic
1073771802 10:106743145-106743167 CAAAGAAAAGAGAGAAGTGGAGG + Intronic
1073809010 10:107132150-107132172 GAGAGAAAAGAGAAAGAAGAGGG - Intronic
1074162806 10:110847749-110847771 CAGAGAGAAGAGGAAAAAGCGGG + Intergenic
1075052372 10:119192232-119192254 CAAAAAAAAAAAAAAAATGGTGG - Intergenic
1075297643 10:121292203-121292225 CAAAGAAAACAAAAAAAAGGGGG - Intergenic
1075376845 10:121985210-121985232 AAAAGAAAAGAAAAAAAAGGAGG - Intergenic
1076436542 10:130449219-130449241 TAGAGAAAACAGAAAAAAGTTGG - Intergenic
1076557408 10:131336281-131336303 CAGAGAAGTGAGAAGACTGGAGG + Intergenic
1076739254 10:132474018-132474040 CAAAGAAAAAAAGAAAATGGGGG + Intergenic
1077069876 11:664265-664287 CAGAGAAAAGAAAAAAAAAAAGG + Intronic
1077563789 11:3283294-3283316 AGGAGAAAAGGGAAAAAAGGAGG - Intergenic
1077569679 11:3329111-3329133 AGGAGAAAAGGGAAAAAAGGAGG - Intergenic
1077791219 11:5442085-5442107 CATAGACCAGAGGAAAATGGGGG - Intronic
1077819274 11:5720054-5720076 GCGAGAAAAGAGAAAAGTGAGGG - Intronic
1077860652 11:6175856-6175878 AAAAGAAAAGAGAAAGCTGGTGG + Intergenic
1077946289 11:6903801-6903823 AAGATGTAAGAGAAAAATGGTGG - Intergenic
1077978223 11:7272357-7272379 AAAAGAAAAGAGATTAATGGAGG - Intronic
1078571870 11:12465551-12465573 GAGAGTAAAAAGATAAATGGGGG - Intronic
1078611300 11:12821907-12821929 AAGAGGAAAGAGAAAAGGGGAGG - Intronic
1079319053 11:19435257-19435279 TAGAAGAAAGAGTAAAATGGTGG - Intronic
1079473365 11:20802021-20802043 CTGAGCAAAAAGAAAACTGGAGG - Intronic
1079531266 11:21456772-21456794 GAGACCAAAGAGAAACATGGTGG + Intronic
1079641916 11:22816201-22816223 GAGAGAGGAGAGAAAAGTGGGGG - Intronic
1079923555 11:26462481-26462503 CAGAGAACACTGAAAAATGATGG - Intronic
1079997570 11:27311049-27311071 AAGAGAAAAGAAAAAAGTGGGGG + Intergenic
1080159776 11:29159905-29159927 AAGAAAAAAGAGAAAAGAGGAGG + Intergenic
1080263212 11:30373357-30373379 GAGAGAAAAAAGAACAATTGTGG - Intergenic
1080452257 11:32387799-32387821 GAGAGCAAAGTGAAAAATGCAGG + Exonic
1080749262 11:35138004-35138026 CACAGAAAGGAGGATAATGGGGG + Intergenic
1080864082 11:36178144-36178166 CTGAAAATAGGGAAAAATGGTGG - Intronic
1080934701 11:36850706-36850728 CTGGGAAAAGATGAAAATGGGGG - Intergenic
1081204352 11:40257796-40257818 CTGAGAACAGAGCAAAATGATGG + Intronic
1081379461 11:42396687-42396709 CAGAAAACAGAGAAAAAGCGGGG + Intergenic
1081390936 11:42527846-42527868 CAGAAAAAGGAGAAAATTAGGGG + Intergenic
1081480438 11:43482147-43482169 AAGAGAAAACAAAAAGATGGTGG - Intronic
1081506787 11:43725858-43725880 AACAGATATGAGAAAAATGGAGG + Intronic
1081811486 11:45916667-45916689 CTCAGAAAAAAGAAAAGTGGAGG - Intronic
1081842630 11:46214201-46214223 AAGAGAAGACAGAGAAATGGAGG - Intergenic
1081907261 11:46677942-46677964 CAGAAAAAAAAAAAAAAAGGTGG + Exonic
1082059436 11:47848059-47848081 CAAAGAAAAGAGGAAAACGTCGG + Intronic
1082127440 11:48449795-48449817 CAGGGAAAAGAAAGAAATGAAGG - Intergenic
1082134840 11:48535456-48535478 CAGATAAAACAGTAAAATGTAGG - Intergenic
1082184299 11:49161451-49161473 AATAGAAAACAGAAAAATGCAGG - Intronic
1082645741 11:55722044-55722066 GAAAAAAAAGAGAAAAATGCTGG - Intergenic
1082821029 11:57544833-57544855 CAAAAAAAAAAAAAAAATGGGGG - Intronic
1082979899 11:59110389-59110411 CTGGGAATAGAGAAAAATGGAGG + Intronic
1082986537 11:59174269-59174291 CAGAGAATAGAGAGGAATGTGGG + Intronic
1083004852 11:59333993-59334015 TACTGAAAAGAGAAAAATAGTGG + Intergenic
1083054172 11:59803813-59803835 GGGAGATAACAGAAAAATGGAGG - Intergenic
1083295690 11:61714291-61714313 CAGAGGCAGGAGTAAAATGGGGG + Intronic
1083607768 11:63989014-63989036 CAGAAAAAAAAAAAAAAAGGTGG + Intronic
1084984966 11:72861070-72861092 AATAGAAAAGAGAAAAACGAGGG + Intronic
1085652404 11:78280303-78280325 CAGGGAAGAGAGAAAACAGGAGG + Intronic
1085658284 11:78337533-78337555 CAGGGAAAAGAGAAAGAAGGTGG + Intronic
1085668922 11:78443014-78443036 CACAGATAAGATAAAAATGTAGG + Intronic
1085688765 11:78648970-78648992 CAGAAAGAGGAGAAAAAAGGAGG + Intergenic
1085869010 11:80327382-80327404 CAGAGACAAGACACAAATCGAGG - Intergenic
1086000236 11:81974766-81974788 AAGAGAAAAGAGCAAGAGGGAGG - Intergenic
1086000757 11:81983383-81983405 CAGAGAAGACAGAAAAAAGGAGG - Intergenic
1086212802 11:84341349-84341371 CTAATAAAAGAAAAAAATGGTGG + Intronic
1086276895 11:85140758-85140780 GAGAGAAAAGAGTATAATGATGG - Intronic
1086433915 11:86763079-86763101 CACAGAAAAAAAAAAAAGGGGGG - Intergenic
1086532690 11:87804329-87804351 CAGAGAACAGAGGACAATGATGG - Intergenic
1086682050 11:89683928-89683950 AATAGAAAACAGAAAAATGCAGG + Intergenic
1086776958 11:90848586-90848608 AAGAGAAAAGAAAAGAAAGGAGG + Intergenic
1086788173 11:90998880-90998902 CAGAAGGAAGAGAAAAATGCAGG + Intergenic
1086812639 11:91329659-91329681 GAGAGAAAAGAGATAAATTTAGG - Intergenic
1086940977 11:92798310-92798332 TTGAGAAAAGAGAAAAACTGGGG - Exonic
1087007607 11:93484733-93484755 CAGGGAAAAGAGAAAACCTGGGG - Intronic
1087058625 11:93957218-93957240 AAGAGAAAAGAGAGAGAAGGAGG + Intergenic
1087212002 11:95454192-95454214 CAGACAAAAAGGAAAAATGCTGG - Intergenic
1087419644 11:97905551-97905573 CAGAGAAAAGAGAAATAATGAGG + Intergenic
1087447163 11:98269523-98269545 CTCAGAAAAGAGGAAAATGTGGG - Intergenic
1087448480 11:98286363-98286385 GATTGAAAAGATAAAAATGGAGG + Intergenic
1087605421 11:100371357-100371379 AAGAAATAAGAGACAAATGGAGG + Intergenic
1087754102 11:102036898-102036920 AAGAGAAGAGAGAGAAAGGGAGG + Intergenic
1087910405 11:103746451-103746473 CAGAGAAAAAAGAAAACTTCAGG - Intergenic
1088405098 11:109467118-109467140 CAAAGAAAAGAAAAAAAAGCAGG + Intergenic
1088434234 11:109793281-109793303 CAGACAAAAGTGAGAAATGGGGG - Intergenic
1088614736 11:111614080-111614102 CAAAAAAAAAAAAAAAATGGGGG - Intronic
1088872771 11:113906025-113906047 AAGATAAAATAGAAAAATGAAGG + Intronic
1088936237 11:114402998-114403020 AAGAGATAAGAGAATAATGAAGG - Intronic
1089076898 11:115745579-115745601 CAGGAGAAAGAGAAAGATGGAGG + Intergenic
1089099899 11:115953819-115953841 CAGGAAATAGAGCAAAATGGTGG + Intergenic
1089187554 11:116629954-116629976 AAGAGGAAAGAGATAAATTGAGG - Intergenic
1089537762 11:119171133-119171155 AAGAAAAAAGAAAAAAAAGGTGG + Intronic
1089660470 11:119982144-119982166 CAGGGAATAGAGAGAAATGGTGG - Intergenic
1089782638 11:120884390-120884412 CAGAGAGAAGAACAAAACGGGGG + Intronic
1089959230 11:122600968-122600990 GAGAGAAAAAAGAAAAAAGAAGG + Intergenic
1090040651 11:123288318-123288340 CTGAGGAAAGGGGAAAATGGGGG - Intergenic
1090106416 11:123857325-123857347 CACAGAAAAAAAAAAAAAGGGGG - Intergenic
1090580993 11:128158871-128158893 CAGAGAAGAGAGTAATATGCAGG + Intergenic
1090629696 11:128635435-128635457 CAGAGACAATTGAATAATGGGGG - Intergenic
1090655409 11:128839893-128839915 CAGAGAAAACAGAAAAGCTGAGG + Exonic
1090663215 11:128896110-128896132 GTGAAAAAAGACAAAAATGGAGG - Intronic
1091193021 11:133709998-133710020 CTAAGGAAAGAGAGAAATGGGGG - Intergenic
1091296969 11:134480729-134480751 CAGAGAGAACAGACAGATGGGGG + Intergenic
1091478245 12:798980-799002 AAGAGAATAGGGAAAAATGAAGG - Intronic
1091725096 12:2840839-2840861 TAGAAAAAAGAGAAAAAAGCAGG + Intronic
1092102001 12:5891265-5891287 TGGAGAAAAGAAAACAATGGGGG - Intronic
1092109591 12:5949584-5949606 CAGGAAAAAAACAAAAATGGAGG - Intronic
1092811301 12:12273694-12273716 AAAAGAAAAAAGAAAAATAGAGG - Intergenic
1092896683 12:13018714-13018736 CAGAGAAATGAAAAAAATGAGGG - Intergenic
1092909054 12:13129201-13129223 CTCAGAAAAGAGTGAAATGGAGG - Intronic
1093095963 12:14972708-14972730 CAGAGAAAGGGAAGAAATGGGGG + Intergenic
1093356488 12:18173786-18173808 CAGAGAAGAAAGAAAAGGGGGGG - Intronic
1093576450 12:20736259-20736281 CAGAGAACAAAAAAAAATGAAGG + Intronic
1093606980 12:21103988-21104010 CAGGGAAAAAAGAAAACTGCTGG - Intronic
1093692275 12:22121871-22121893 CAGAGAAAGAAGGAAGATGGGGG - Intronic
1093841285 12:23904842-23904864 CAAAGAGAAGAGCAAAAAGGTGG - Intronic
1094098895 12:26739840-26739862 CATAGAAAAGTGAACAATTGAGG - Intronic
1094227682 12:28064442-28064464 CAGAGCAAAGAAAAAAAGAGGGG - Intergenic
1094280318 12:28730270-28730292 CAGAGAAAAGTGGAAAAGGGTGG - Intergenic
1094404640 12:30103668-30103690 AACAGAAAACAGAAAAATAGAGG - Intergenic
1094569404 12:31628558-31628580 CAGATAAAAGAGTGAAATGTAGG - Intergenic
1094681727 12:32673254-32673276 CAAAAAAAAGAAAAAAAAGGGGG + Intergenic
1094790427 12:33906930-33906952 CAAAGAGAAAAGAACAATGGGGG + Intergenic
1095040430 12:37434979-37435001 CTGTGGAAATAGAAAAATGGTGG - Intergenic
1095129104 12:38516849-38516871 CACTGAAATGAGAAAAAGGGTGG + Intergenic
1095399845 12:41801408-41801430 CAGATGAAAGAGAAGAATGATGG + Intergenic
1095427468 12:42092588-42092610 AAGAGAAAACAGACAACTGGGGG + Intronic
1095433932 12:42166951-42166973 ATAAGAAAACAGAAAAATGGTGG - Intronic
1095486176 12:42686909-42686931 CAGGAAAAAAAAAAAAATGGAGG - Intergenic
1095811660 12:46378503-46378525 AAAAGAAAAAAGAAAAAGGGAGG - Intergenic
1096188406 12:49599042-49599064 TAGAGCAAAAAGAGAAATGGAGG + Intronic
1096413461 12:51393024-51393046 GAAAGAAAAAAGAAAAAAGGAGG - Intronic
1096435169 12:51583913-51583935 AAAAGTAAAGAGTAAAATGGTGG - Intergenic
1096438188 12:51613570-51613592 CATTGAAAACAGAAAAATAGAGG - Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096776215 12:53965984-53966006 CAGAGAAAAGGCTGAAATGGAGG - Intergenic
1097437453 12:59568898-59568920 CAGAGAAAATAGAAGAGTCGAGG - Intergenic
1098340515 12:69445771-69445793 AAAAAAAAAGAAAAAAATGGGGG + Intergenic
1098769006 12:74528690-74528712 CAGAAAAAAAAGAAGAATGATGG - Intergenic
1098780785 12:74683906-74683928 CAGTGAAAGAAGAAAAAAGGTGG + Intergenic
1098830380 12:75354149-75354171 CAGGGAAGAGAAAAAAAAGGGGG + Intronic
1098850172 12:75586950-75586972 AAGAGAAAATGCAAAAATGGGGG - Intergenic
1099316178 12:81084755-81084777 GAGAGAAAAGATAAAAATAGTGG + Intronic
1099327987 12:81244035-81244057 TAGACAAAAGAAAAAAATTGAGG - Intronic
1099480405 12:83158632-83158654 CAGAGAAGAGACCAGAATGGCGG - Intergenic
1100241643 12:92715519-92715541 GAGTGAAGAGAGACAAATGGGGG - Intergenic
1100555516 12:95689416-95689438 CAAAGAAACAAGAAAGATGGAGG - Intronic
1100680910 12:96919540-96919562 TAGAGAAAAGAGAAAAATCATGG - Intronic
1100739792 12:97579460-97579482 AAGAGGAAAGGGAAGAATGGAGG - Intergenic
1100745021 12:97636132-97636154 GAGAGAAAAGAGAAAAAGAAAGG - Intergenic
1100806640 12:98292466-98292488 AAGAGAGAAAAGAAGAATGGAGG + Intergenic
1100927883 12:99570337-99570359 CAGATAAAAAAAAAAAATGAAGG + Intronic
1101145728 12:101838867-101838889 CAGAGCAAACAGAATAAGGGGGG - Intergenic
1101424826 12:104579327-104579349 CAGGGACAAGAGCAAAGTGGTGG - Intronic
1101543584 12:105687767-105687789 CACAGAAAGGGGAAAAATGTGGG - Intergenic
1101730624 12:107424310-107424332 TAGAGAAAGGAGAAAAAGGCAGG - Intronic
1102052956 12:109876503-109876525 CAGAGAAGAAAGAAAGAGGGAGG + Intronic
1102162296 12:110779296-110779318 GAGGGAAAAAAGAGAAATGGGGG + Intergenic
1102352034 12:112200150-112200172 CAAAAAAAAAAAAAAAATGGGGG - Intronic
1102988610 12:117298636-117298658 TAGAGAAAAGAGAAATTTGAAGG + Intronic
1103162840 12:118744492-118744514 GAGAGAAAAGAGAAAGAGGAAGG + Intergenic
1103183009 12:118930737-118930759 GAGAGAAAAGAGAGAACAGGAGG + Intergenic
1103241532 12:119417435-119417457 AAGAGAAAAAGGAAAAAGGGGGG - Intronic
1103476285 12:121221393-121221415 CAAAAAAAAAAAAAAAATGGTGG - Intronic
1103677246 12:122665551-122665573 AAGAGAAAAGAGAAGAAAAGAGG - Intergenic
1103787214 12:123441891-123441913 CAGATGAAAGTGAAGAATGGGGG + Intergenic
1104354614 12:128074342-128074364 ATAAGAAAAGAGAAAAATAGAGG + Intergenic
1104459492 12:128943333-128943355 GAGAGAAAAGAGAAAACCTGTGG - Intronic
1104565925 12:129883043-129883065 CAGGGAAAAGGGAAAGAAGGAGG + Intronic
1104690079 12:130819017-130819039 AAGTGAAAAAAGAAAAATGCAGG + Intronic
1105299841 13:19123302-19123324 CAGAGAGAAGAGAAAGAGGAAGG - Intergenic
1105302435 13:19148279-19148301 AAGAGGAAAGAGATAAATTGAGG - Intergenic
1105383488 13:19909400-19909422 CAGAGAAAGAAGAAAAAATGAGG - Intergenic
1106278053 13:28234006-28234028 CTGAAAGAAAAGAAAAATGGAGG - Intronic
1106825571 13:33516940-33516962 CAGAAAAAAAAAAAAAAAGGAGG + Intergenic
1106944044 13:34805560-34805582 CAGGGAAATGAGAAGAATGTTGG - Intergenic
1107010770 13:35668640-35668662 CAAAGAAAAGGGGAAAATGAGGG + Intronic
1107041137 13:35948916-35948938 CAGAGAGAGGAGTGAAATGGAGG - Intronic
1107156533 13:37173663-37173685 CAGAAAAAAAAAAAAAATGGTGG - Intergenic
1107703319 13:43072376-43072398 CAGAGAGATGAGAAAGATGTTGG + Intronic
1107819639 13:44274621-44274643 TAGAGAAAAGAACAAAATGGAGG + Intergenic
1107924224 13:45242818-45242840 CTTAGAAATGAGATAAATGGAGG + Intronic
1108118109 13:47152450-47152472 TAGAGAATAGAGAAAATTGAAGG - Intergenic
1108190235 13:47930838-47930860 AAGAGAAAAGAGAGAAAGGAAGG + Intergenic
1108221793 13:48241510-48241532 GAGTTAAAAGAGAAACATGGAGG - Intronic
1108296694 13:49027758-49027780 CATAAAAAAGGCAAAAATGGAGG + Intronic
1108380815 13:49852562-49852584 AAAAGAAAAGAAAAAAATGGTGG + Intergenic
1108408976 13:50129259-50129281 CAGAGAAAAAAAAAAAAAGGTGG - Intronic
1108546499 13:51500622-51500644 AAGAGAGAAGAGAAAGATGTGGG + Intergenic
1109069738 13:57749246-57749268 AATAGAAAAAAGAAAAGTGGAGG + Intergenic
1109079695 13:57883055-57883077 AAGAGATAAGAGAAAAAAGCAGG - Intergenic
1109167498 13:59054125-59054147 TACTGAAAAGAGAAAATTGGAGG + Intergenic
1109175199 13:59146468-59146490 CAGAGAAAAGAGCAAGATGATGG + Intergenic
1109201399 13:59435369-59435391 GGGAGAGAAGAGGAAAATGGTGG - Intergenic
1109215864 13:59589177-59589199 CAAAAAAAAAAAAAAAATGGTGG + Intergenic
1109229683 13:59741720-59741742 GAAAGAAAAGAGAAAAAAGAGGG + Intronic
1109357404 13:61248091-61248113 CAAAAAAAAGAAAAAAAAGGAGG - Intergenic
1109361686 13:61301473-61301495 AATAGAAAAGAGAAAAAAGCAGG + Intergenic
1109464156 13:62706744-62706766 CAGAGAAGAGAAAAAGAAGGTGG - Intergenic
1109490482 13:63091686-63091708 AAGAGAATAGAGTAAAATAGCGG + Intergenic
1109664892 13:65521257-65521279 CAGAGAAAAGTGAAAGACAGAGG - Intergenic
1110002512 13:70222233-70222255 AAGAGAAAAGTGAAAAATATGGG - Intergenic
1110045620 13:70826420-70826442 GAGAGAAATAAGAAAAATGTTGG - Intergenic
1110297365 13:73884233-73884255 CTGAGAAAAGAGAAGAATATAGG - Intronic
1110317105 13:74121979-74122001 TAGATTAAAGACAAAAATGGGGG + Intronic
1110473929 13:75891190-75891212 AAGAGATAACAGCAAAATGGTGG - Intergenic
1110504667 13:76271794-76271816 CAGGGGATAGAAAAAAATGGAGG + Intergenic
1110776784 13:79416924-79416946 AAGAGAAAAGGAAAGAATGGTGG - Intergenic
1110911431 13:80970449-80970471 CAGAGAAAAGGCAAATATGTTGG + Intergenic
1110930266 13:81206554-81206576 CTGAGAAAGGAGAAAAATTTTGG - Intergenic
1111123667 13:83884389-83884411 CAAGGAAAACAGAAAAATGCTGG + Intergenic
1111179845 13:84650172-84650194 TTGAGAAAAGAAAAAAATGAAGG + Intergenic
1111187425 13:84757125-84757147 CAGACAAAAGAGAAAAACTCAGG - Intergenic
1111286895 13:86105818-86105840 CACAGAAAACAGAAAAAAGCAGG - Intergenic
1111325273 13:86686221-86686243 CAAATAATAGAGAAAAATTGGGG + Intergenic
1111567933 13:90041226-90041248 CAGAGAAAAATGAAACATGAAGG + Intergenic
1111592405 13:90367185-90367207 CAGAGAAAAGAAAAGAAGAGGGG + Intergenic
1111649324 13:91069334-91069356 GAGAAAAGAGAAAAAAATGGAGG - Intergenic
1111682412 13:91459660-91459682 CAAAGAAAGGAGGAAATTGGTGG + Intronic
1111717523 13:91897824-91897846 CACAGCAAATAGAAATATGGGGG - Intronic
1111836758 13:93397756-93397778 CAGAGAAAAAAAAAAAGAGGAGG - Intronic
1111875009 13:93882057-93882079 AAGAGAAAAGAAAAGAAAGGAGG - Intronic
1111915694 13:94357634-94357656 CAGTGAAAATAGACACATGGTGG - Intronic
1111950730 13:94707255-94707277 GAGAGAAAAAAGAAAAGGGGGGG + Intergenic
1112210925 13:97376154-97376176 GAGAGAAAAGAGAACATTTGAGG + Intronic
1112699810 13:101993761-101993783 CAGAGAAGGCAAAAAAATGGAGG + Intronic
1112805270 13:103157998-103158020 CAGAGAGAGGAGAAAATTAGTGG + Intergenic
1112843920 13:103614392-103614414 AAGAGAAAAAAGAAACATAGGGG + Intergenic
1112884311 13:104149578-104149600 CAAAGAAAACAAAGAAATGGAGG + Intergenic
1113098663 13:106693440-106693462 AAGAGAAAAGAAAAAAATAGAGG + Intergenic
1113230725 13:108212198-108212220 AAAAGAAAAGAAAAAAAGGGGGG + Intronic
1113324909 13:109271705-109271727 CAGGCAATAGAGAAAGATGGCGG + Intergenic
1113359756 13:109619409-109619431 TAGAAGAAAGAGAAGAATGGTGG - Intergenic
1113572334 13:111367144-111367166 CAAAGAAAAGAAGAAAATGTAGG + Intergenic
1113883356 13:113642030-113642052 AAGGGGAAAGAGAAAAATGAAGG - Intergenic
1114030464 14:18574320-18574342 CAGACAAAAGAAAGAAATAGAGG - Intergenic
1114131551 14:19799088-19799110 CAGAAAACAAACAAAAATGGTGG + Intronic
1114134401 14:19830798-19830820 CAGAGAAAAGGGGAATATGTTGG - Intergenic
1114345767 14:21793094-21793116 CAGAGAAAAGGGGAAGATTGAGG - Intergenic
1114820782 14:26016952-26016974 AAGAGAAAACAGAAAAATGTAGG + Intergenic
1114960683 14:27884544-27884566 CAGAGAAAAGACTAAATTAGGGG - Intergenic
1115131532 14:30057762-30057784 CTGAGAAAACAGAAGAAAGGGGG + Intronic
1115244538 14:31281851-31281873 CATAGAAGAGAGACAGATGGAGG + Intergenic
1115555945 14:34545157-34545179 CAGAAAAAAAAAAAAAATCGAGG + Intergenic
1115557963 14:34557930-34557952 CAGAAAAAAAAAAAAAATCGAGG - Intergenic
1115854936 14:37621227-37621249 CTGAAAAAAAAGAAAAATGAAGG - Intronic
1115962536 14:38851823-38851845 CAGAAAAAAAAAAAAAAAGGTGG + Intergenic
1116042658 14:39703739-39703761 CATAAAAAAGAACAAAATGGAGG - Intergenic
1116209567 14:41917439-41917461 CAGAGAAGACAGAGAAAAGGGGG - Intergenic
1116295640 14:43104243-43104265 CAGAAAAAAAAGAAAAAAGCAGG + Intergenic
1116316109 14:43394540-43394562 CCCAGAAAAGGGAAGAATGGGGG - Intergenic
1116424364 14:44771562-44771584 GAGAGAGAAGAGAAAACTGTAGG - Intergenic
1116553911 14:46278804-46278826 CACAGAAGAGAGTGAAATGGTGG - Intergenic
1116620049 14:47189990-47190012 CAGATAAATGAGACAAATGATGG - Intronic
1116803831 14:49471637-49471659 GAGAGAACAGAGAAAAACAGAGG + Intergenic
1116821163 14:49629270-49629292 CAAAAAAAAGAAAAAAAGGGGGG - Intronic
1116880081 14:50158728-50158750 CAAAGTAAAAAGAAAAAGGGAGG - Intronic
1116913798 14:50500798-50500820 CAAATAAAAGAGAGAAATCGAGG + Intronic
1117099486 14:52331919-52331941 AAGAGACAAGAGAGAAATGATGG - Intergenic
1117127106 14:52640985-52641007 AAGAGAGAAAAAAAAAATGGAGG + Exonic
1117481375 14:56148666-56148688 CAGAGAACACAGAAGAAAGGAGG - Intronic
1117487574 14:56213589-56213611 CATTGTAAAGAGAAGAATGGTGG + Intronic
1117644490 14:57837321-57837343 CAGCGAAAAGAGCAGAAGGGAGG + Intronic
1117661399 14:58009333-58009355 CAGAGGAAGGAGGAAAAAGGGGG - Intronic
1118005840 14:61563558-61563580 TAGAGAAAGGAGAGAAATGAGGG - Intronic
1118395950 14:65336715-65336737 CAGAGAGAAGAGACTAAGGGTGG + Intergenic
1118449512 14:65887126-65887148 CAAAGAAAAAAAAAAAAAGGTGG + Intergenic
1118595677 14:67433335-67433357 CAGAGAGAAGAGAAAAGGGAGGG + Intergenic
1118684108 14:68273680-68273702 AAGAAAAAAAAGAAAAATGATGG - Intronic
1118789087 14:69072647-69072669 GAGAGAAAAGAAAAAAAATGTGG + Intronic
1118904174 14:70011462-70011484 CTGGGAAAAGAGAGATATGGGGG - Intronic
1119021575 14:71120563-71120585 AAGAAAAAAGAAAAAAATGATGG + Intergenic
1119926731 14:78501751-78501773 CACAGAAAATATAAAAAGGGTGG - Intronic
1119995736 14:79251778-79251800 AATAAAAGAGAGAAAAATGGGGG - Intronic
1120017582 14:79491323-79491345 CATAGAATAGAAAAACATGGAGG - Intronic
1120362070 14:83516597-83516619 GAGAGAAAGGCGAAAAATGTAGG - Intergenic
1120428882 14:84388439-84388461 CAAAGAAAAGAGTAGAATGGCGG + Intergenic
1120486679 14:85122741-85122763 CAAAAAAAAAAAAAAAATGGTGG + Intergenic
1120993652 14:90398426-90398448 CAGAGAAAGCAGAAACGTGGAGG - Intronic
1121215760 14:92246415-92246437 GAAAGAAAAGATAGAAATGGTGG - Intergenic
1121629685 14:95413179-95413201 GAGAGAAGAGAGAGAAAAGGAGG - Intronic
1121877544 14:97467312-97467334 GAGAAAAAAGGGAAAAAAGGAGG + Intergenic
1121957014 14:98223463-98223485 CAGAGGGAAGAGTAAGATGGCGG + Intergenic
1122189862 14:100032746-100032768 CAGAAAAAAGAGAAATTTTGTGG - Intronic
1122366958 14:101200032-101200054 CAAAGAAAAAAAAAAGATGGCGG + Intergenic
1122503910 14:102219588-102219610 CAGAGCAAAGGGGAAAACGGTGG - Intronic
1122799441 14:104222298-104222320 GACAGAAAAGATAAAAATGATGG + Intergenic
1123057908 14:105580706-105580728 CAGAGATGGGAGAAAAAGGGAGG - Intergenic
1123184203 14:106499048-106499070 CAGTGAAAAGGGAACACTGGCGG - Intergenic
1123577457 15:21686393-21686415 CAGAGAAAAGGGGAATATGTTGG - Intergenic
1123614080 15:22128863-22128885 CAGAGAAAAGGGGAATATGTTGG - Intergenic
1124095179 15:26642532-26642554 CAAAGAAATGAGAAACATGAAGG + Intronic
1124151785 15:27186628-27186650 CAGAGAAAAGGGAATATTGTTGG - Intronic
1124444872 15:29721680-29721702 AAGAGAAGACAGAAAAATGAGGG + Intronic
1124523929 15:30430680-30430702 AAAAGAAAAGAAAAAAAAGGTGG + Intergenic
1124534737 15:30535536-30535558 AAAAGAAAAGAAAAAAAAGGTGG - Intergenic
1124763912 15:32472064-32472086 AAAAGAAAAGAAAAAAAAGGTGG + Intergenic
1124796471 15:32785858-32785880 CAAAGAAAAGAGACACATTGAGG + Intronic
1125078153 15:35644764-35644786 AATGGAAAAGAGAAAAATGCAGG + Intergenic
1125315602 15:38427966-38427988 CAGATAAAATAGAAATCTGGAGG + Intergenic
1125497536 15:40211024-40211046 AAGAGAACAGAGAAAACTGAGGG - Intronic
1125550244 15:40539548-40539570 CAGAGACAAGAGACAAACGGAGG + Intronic
1125754875 15:42056883-42056905 CAGAAAGAAGAGAAAAGTAGCGG + Intergenic
1125799760 15:42435072-42435094 TAGAATAAAGAGAAAAATGTAGG - Intronic
1125835811 15:42749726-42749748 AAGGGAAAAAAGAAAAATGAGGG - Intronic
1126265839 15:46753018-46753040 CAAATAAAAGAAAAAATTGGAGG - Intergenic
1126294233 15:47119396-47119418 GAGAAAAAAGAGAAAAATGATGG + Intergenic
1126301675 15:47203549-47203571 CATAGGGAAGAGGAAAATGGGGG - Intronic
1126316491 15:47375397-47375419 AAAAGAAAATAGAAAAATGGAGG - Intronic
1126491666 15:49243637-49243659 CAGAGAAAACAGGAAACTAGAGG + Intronic
1126522373 15:49610612-49610634 TATAGAAAACAGAAAAAAGGTGG - Intronic
1126522846 15:49615962-49615984 CAGATAATAGAAAAAAATAGAGG - Intronic
1126622320 15:50652367-50652389 AACAGAAAAGAGAAAAATCGTGG + Intronic
1126875872 15:53040415-53040437 CAGAAAAAAGAGGAAAAAGTAGG + Intergenic
1126932632 15:53671925-53671947 AAGAGAAAAGAGAAAAAAAAGGG + Intronic
1127024339 15:54786340-54786362 AAAAGACAAGAGATAAATGGTGG + Intergenic
1127374494 15:58370542-58370564 CAGTGAAAAGAAAGGAATGGGGG + Intronic
1127471147 15:59291533-59291555 CAGCAAAAAGAGAACAAAGGTGG + Intronic
1127639119 15:60898699-60898721 AAAAAAAAAGAGAGAAATGGAGG + Intronic
1127710811 15:61596112-61596134 CAGAGAAAAGGGAAAGATCAAGG + Intergenic
1127812491 15:62576676-62576698 CACATAAAAGAGTAATATGGAGG + Intronic
1127839763 15:62820942-62820964 AAGAGAAACCAGAAAATTGGAGG - Intronic
1127976858 15:64004124-64004146 TAAGAAAAAGAGAAAAATGGAGG - Intronic
1128275778 15:66352588-66352610 GAGAAAAAAGAAAAAAAAGGAGG - Intronic
1128502835 15:68240648-68240670 CAGATAAAATAGATAAATGTTGG + Intronic
1128859498 15:71054282-71054304 GAAAGAAAAGAGAAAGAAGGGGG + Intergenic
1129013250 15:72442198-72442220 AAGAAAAAAGAGAAAAATGAAGG + Intergenic
1129204749 15:74030259-74030281 CACAAAAGAGAGAAAGATGGTGG + Intronic
1130141969 15:81235166-81235188 CAGAGAAAAGATAAGGTTGGGGG + Intronic
1130330154 15:82916134-82916156 CAGAGGAAACAAAATAATGGGGG + Intronic
1130827944 15:87568652-87568674 CAGTGAAAAAAGGAAAATGCAGG + Intergenic
1131014862 15:89049914-89049936 AATAGAAAAGAGAAAAATACGGG - Intergenic
1131176996 15:90215982-90216004 AAAAGAAAAAAAAAAAATGGAGG - Intronic
1131187414 15:90286560-90286582 AAAAGAAAAGAAAAAAAGGGCGG + Intronic
1131578286 15:93614274-93614296 AAGAGAAGAGAGAAATGTGGAGG + Intergenic
1131579046 15:93622876-93622898 CTGATCAAAGAGAAAAATGAAGG - Intergenic
1131660475 15:94509953-94509975 CTGAGCAAAGAGAAAAAAGCTGG + Intergenic
1131682227 15:94736225-94736247 AAAAGAAAAGAAAAAAATGGTGG - Intergenic
1131958440 15:97763163-97763185 CATACAAAAGAAAAAAATGGTGG + Intergenic
1202986326 15_KI270727v1_random:420638-420660 CAGAGAAAAGGGGAATATGTTGG - Intergenic
1132952427 16:2571047-2571069 AAGGGAAAAAATAAAAATGGGGG - Intronic
1132961924 16:2629123-2629145 AAGGGAAAAAATAAAAATGGGGG + Intergenic
1132980998 16:2738684-2738706 CAGAGACCAGAGAAAAACAGTGG + Intergenic
1133019514 16:2960992-2961014 CAGAGAGATGAGAAAAAGGAAGG + Intergenic
1133124026 16:3633215-3633237 CAGAGAAAGCAGAAAAAGAGTGG - Intronic
1133482260 16:6182286-6182308 GAGAGAACAGAGTAAAATTGGGG - Intronic
1133523624 16:6582677-6582699 AAGTGAGAAGAGAGAAATGGTGG - Intronic
1133532909 16:6672471-6672493 GAAAGAAAAAAGAAAAAGGGAGG + Intronic
1133534781 16:6691353-6691375 CAGAGAAGAGTGAAGAATGATGG - Intronic
1133694135 16:8244646-8244668 CGAAAAAAAGAAAAAAATGGTGG - Intergenic
1134028797 16:10975328-10975350 CAAAGAAAAGAAAAAAACAGTGG + Intronic
1134140125 16:11711212-11711234 CAGAGAAAACAGAGTAAGGGTGG + Intronic
1134290234 16:12898881-12898903 CAGAGAAAAGAGACAAAATCTGG - Intergenic
1134369609 16:13610835-13610857 CAGAGAACAGAGAACAGAGGAGG - Intergenic
1134376048 16:13674836-13674858 CAGAGAAAGGAGGTAAGTGGAGG - Intergenic
1134569381 16:15278459-15278481 CAGAGAGAAGAGGAAAATGGAGG - Intergenic
1134732996 16:16477586-16477608 CAGAGAGAAGAGGAAAAGGGAGG + Intergenic
1134826575 16:17289330-17289352 CAGAGAAAGGGGAAAAAAGCTGG - Intronic
1134934442 16:18234387-18234409 CAGAGAGAAGAGGAAAATGGAGG - Intergenic
1134981554 16:18614387-18614409 AAAAGAAAAGAAAAAAAGGGGGG + Intergenic
1135088090 16:19490763-19490785 AAGAGAAAAGAAAAAAAGGAAGG - Intronic
1135096187 16:19566748-19566770 CAAAAAAAAGAAAAAAAAGGGGG - Intronic
1135206618 16:20490382-20490404 CAGAGAAAAGGGACAAAGGGTGG + Intergenic
1135212268 16:20533250-20533272 CAGAGAAAAGGGACAAAGGGTGG - Intergenic
1135229230 16:20690091-20690113 CAGAGAAAAGAAAAAGAAGGTGG + Intronic
1135560750 16:23474862-23474884 CAGGGAAAAAAAAAAAAAGGTGG + Intronic
1136074799 16:27809657-27809679 GAGAGAAAAGAGAGGGATGGAGG - Intronic
1136697028 16:32091267-32091289 TAGAGAACAGAGAAAAAAGTAGG - Intergenic
1136797527 16:33034557-33034579 TAGAGAACAGAGAAAAAAGTAGG - Intergenic
1136939325 16:34506785-34506807 TAGAGAACAGAGGAAAATGTAGG - Intergenic
1136960494 16:34841776-34841798 TAGAGAACAGAGGAAAATGTAGG + Intergenic
1137084923 16:36107968-36107990 TAGAGAACAGAGAAAAAAGTAGG - Intergenic
1137224152 16:46486308-46486330 CAGTGAAAAAAGAAAACTGCAGG + Intergenic
1137253365 16:46756413-46756435 CAGAGAATGAAGAAATATGGAGG + Intronic
1137411665 16:48233476-48233498 AAGAGAAAAGAGAGAGAAGGAGG + Intronic
1137415547 16:48274967-48274989 CAGACAAGAGAGAAAAATATAGG - Intronic
1137556948 16:49476693-49476715 AAAAAAGAAGAGAAAAATGGTGG - Intergenic
1137593489 16:49708278-49708300 AAAAGAAAAGAAAAAAGTGGTGG - Intronic
1137886203 16:52106493-52106515 TAGGGAGAAGAGAAAAATGAAGG + Intergenic
1138074092 16:54023763-54023785 AAAATAATAGAGAAAAATGGGGG + Intronic
1138159840 16:54743092-54743114 CAAAGAAATGAAAAAAATGATGG + Intergenic
1138229014 16:55324325-55324347 AAGAGACAGGAGAAAAGTGGGGG - Exonic
1138566628 16:57838164-57838186 AAGAACAAAGAGAAAAATGCAGG + Intronic
1138585950 16:57970648-57970670 AGGAGGAAAAAGAAAAATGGGGG - Intronic
1138717485 16:59040580-59040602 AAGAGAAAACAGAAAACTGAGGG + Intergenic
1138768864 16:59637808-59637830 TACAGAAAAGAACAAAATGGAGG + Intergenic
1138821464 16:60264960-60264982 AAAAGAAAAGAGAAAATTAGTGG - Intergenic
1139041198 16:63001150-63001172 GAGAGAAAAGAGCACAATAGGGG - Intergenic
1139089839 16:63632015-63632037 CAGAGCAAAGACAAGAAAGGAGG + Intergenic
1139272422 16:65696721-65696743 AAGAGGAAAGAGAAAGAAGGAGG + Intergenic
1139394076 16:66626132-66626154 CAGAATAAAAAGAAAAAGGGAGG + Intronic
1139554089 16:67695295-67695317 AAGAGAAAAGAGAGAGATGGTGG - Intronic
1139618043 16:68112782-68112804 TAGAGAAAAAAAAAAAATGTCGG - Intronic
1140080441 16:71741866-71741888 CAAAGAAAAGTGAAAATTTGAGG - Intronic
1140543601 16:75784288-75784310 CACAGCAAAGAAAACAATGGAGG - Intergenic
1140551401 16:75870081-75870103 CAAAGAAAAGAGACAAAAGAAGG + Intergenic
1140735200 16:77892071-77892093 CAAAGAAAAGAGATGAATGTGGG + Intronic
1140787892 16:78361597-78361619 AAAAGAAAAGAAAGAAATGGGGG - Intronic
1140892513 16:79297302-79297324 CAGAGAAAATAGCAAAACGGCGG + Intergenic
1141202852 16:81910920-81910942 AAGGGAAAAGAGAAAAGGGGAGG - Intronic
1141341815 16:83210461-83210483 AAGAGAAATCAGAAACATGGAGG + Intronic
1141433006 16:83980610-83980632 CCGAGAAAACAGAACAAGGGTGG + Intronic
1141645531 16:85365382-85365404 CAGGGAAAAGAGAAGAGTGAAGG - Intergenic
1141813631 16:86393750-86393772 GGAAGAAAAGGGAAAAATGGTGG + Intergenic
1141856389 16:86683913-86683935 GAGGGACAAGAGAGAAATGGAGG - Intergenic
1141856402 16:86684060-86684082 GAGGGACAAGAGAGAAATGGAGG - Intergenic
1142542520 17:671363-671385 GAAAGAAAAGAGAAAGAGGGAGG + Intronic
1142589290 17:994533-994555 CAAAAAAAAGAAAAAAAAGGTGG - Intergenic
1143104575 17:4522578-4522600 CTGAGAGAAGAGAAAGAGGGAGG - Intronic
1143933186 17:10452863-10452885 AAGAGCCAAGAGAAAACTGGAGG - Exonic
1143937475 17:10501842-10501864 AAGAGCAAAGAGAAAACTAGAGG - Exonic
1144036109 17:11367436-11367458 CAGAGAACAGGGAACACTGGAGG + Intronic
1144036797 17:11373783-11373805 CAGAGAAAAGTCATAAATAGTGG - Intronic
1144232174 17:13218781-13218803 AAGAAAAAAGAGAGAAAGGGAGG - Intergenic
1144359232 17:14475869-14475891 CAAAGAAAAGAAAAAAAAAGGGG - Intergenic
1144523496 17:15970049-15970071 CACTGAGAAGAGAAACATGGAGG - Intronic
1144653999 17:17024112-17024134 CAAAGAAAAAAAAAAAAAGGTGG - Intergenic
1144876154 17:18398533-18398555 CAGATAAAGGAGAAACAAGGTGG - Intergenic
1145156074 17:20545887-20545909 CAGATAAAGGAGAAACAAGGTGG + Intergenic
1145720242 17:27064720-27064742 TATAGAAAAGAATAAAATGGGGG + Intergenic
1145816143 17:27796479-27796501 AATAGAAAAGAAAAAAATAGGGG + Intronic
1145854621 17:28142192-28142214 CAGAAAAAAAAGAAAAAAGCGGG - Intronic
1145860161 17:28203061-28203083 CAGAGAAAAGAAAGCTATGGGGG + Intergenic
1146599146 17:34198776-34198798 CAGAGAAAGGAAAGAAAGGGAGG + Intergenic
1146940066 17:36838281-36838303 CAAAGAAAAGAAAACAGTGGAGG - Intergenic
1146961263 17:36982031-36982053 CAGAGAGAAAAGCAGAATGGTGG - Intronic
1147805776 17:43129992-43130014 CAAAGAATGGAGAAAACTGGGGG + Intergenic
1147811433 17:43172679-43172701 CAAAGAATGGAGAAAATTGGGGG + Intronic
1147966202 17:44195524-44195546 CAGAGAAAAGAGAAGGACAGGGG + Intronic
1148041995 17:44715114-44715136 AAGAGAAAAGAGAAAATAGAAGG - Intronic
1148177148 17:45576601-45576623 CAAGGAAAAGAGAAATAAGGGGG + Intergenic
1148452792 17:47790860-47790882 CAGTGAAAAGAGCAACTTGGAGG - Intergenic
1148817952 17:50344286-50344308 AAAAAAAAAGAGAGAAATGGGGG + Intergenic
1148971056 17:51482103-51482125 CAGAAAAAATAGAAAAATGCTGG + Intergenic
1149403284 17:56321115-56321137 CAAAGAAAAAAGAAAAGGGGTGG - Intronic
1149484951 17:57035340-57035362 CAAAAAATACAGAAAAATGGTGG - Intergenic
1149683906 17:58524360-58524382 TAGGCAAAAGGGAAAAATGGTGG - Intronic
1149750631 17:59142172-59142194 CAAAGAAAATAGAAGAATTGTGG - Intronic
1149929839 17:60740514-60740536 AAGAAAAAAGAAAAAAAAGGAGG + Intronic
1150225219 17:63520999-63521021 CAGAGAATAGGGAAAACTTGAGG + Intronic
1150235957 17:63592902-63592924 AAGAGAAAAGAGAAAAAGGAGGG - Exonic
1150502032 17:65660286-65660308 GAGAGAAAAGAGAAGGAGGGAGG - Intronic
1150510398 17:65746190-65746212 AAAAGAAAAGAAAAAAATGCAGG + Intronic
1150688777 17:67344636-67344658 CAGAGGAAGGTGAAAAAAGGTGG - Exonic
1150931815 17:69592966-69592988 GAGAGAGAAGAAAAAAATGGAGG - Intergenic
1151356023 17:73559062-73559084 TAGAGAAGAGAGAAAAGGGGAGG - Intronic
1152439200 17:80295167-80295189 CAGTAAAAGGAGGAAAATGGGGG - Intronic
1152913031 17:83016450-83016472 CAGAGAGAAGAGAATAAAGGAGG + Intronic
1203214678 17_KI270730v1_random:111534-111556 CAGAGAAAAGACAAATATATAGG - Intergenic
1152971475 18:165842-165864 CAGATAAAAGAGATAATTAGTGG + Intronic
1153139104 18:1952220-1952242 CAGATAAAAGAGAGAGAGGGAGG - Intergenic
1153530042 18:6036960-6036982 AGAAGAAAAGAGAAAAATGACGG + Intronic
1153532439 18:6061696-6061718 CAGAGAAGGGAGAAAAAGAGAGG - Intronic
1153684417 18:7530951-7530973 CAGAGACAACTGAAACATGGAGG - Intergenic
1153760899 18:8330981-8331003 TATAGAAAAGAATAAAATGGGGG - Intronic
1154145459 18:11862875-11862897 CAAAAAAAAAAAAAAAATGGTGG - Intronic
1154930503 18:20990225-20990247 CAAAGAAATGAGAAAACTGAGGG + Intronic
1154945746 18:21159845-21159867 AAGAGAAAAAAGAAAAAAGAAGG - Intergenic
1155168424 18:23249305-23249327 CAGATAATAGAGTAGAATGGAGG + Intronic
1155398923 18:25416904-25416926 CACATAAAAGAGAAAAATAGAGG - Intergenic
1155443602 18:25886629-25886651 GAGAGAAATGAGAGAAATTGGGG + Intergenic
1155641661 18:28024881-28024903 AAGAGTAAAAAGAAAAAGGGAGG + Intronic
1155679569 18:28473411-28473433 TAGAGAAGACAGAAAAATGTGGG + Intergenic
1156151174 18:34245114-34245136 AATAGAAAAGAGAAAAAAGCAGG - Intergenic
1156526273 18:37770266-37770288 GAGAGAAAAGAGGTAAATTGAGG - Intergenic
1156584707 18:38419278-38419300 CAGAGAAAATATAAAAAGGAAGG - Intergenic
1156816204 18:41314341-41314363 CAGAGAAACTAGGAAAATAGAGG + Intergenic
1157348020 18:46858097-46858119 CAGAGTACAGAGAAAAAAGGCGG + Intronic
1157390299 18:47296534-47296556 CAGTGCAAGGAGAGAAATGGAGG + Intergenic
1157579773 18:48766890-48766912 CTGAGGACAGAGAGAAATGGAGG - Intronic
1157744981 18:50127515-50127537 CAGCTGAAAGAGAACAATGGAGG + Intronic
1157981249 18:52383690-52383712 CAGAGAAACCAGGAAAATGAAGG - Intronic
1157990625 18:52491651-52491673 CAATGAAGACAGAAAAATGGAGG + Intronic
1158402706 18:57135196-57135218 CAGATAAAGGAAAAAAATCGTGG + Intergenic
1158606825 18:58902929-58902951 CAGAGGAAAAAGAAAAACGAGGG - Intronic
1159111317 18:64059540-64059562 CAGAGAAAAGGGGAAAAGGAAGG - Intergenic
1159162697 18:64663679-64663701 TAGAGAAAAGGGAAAATTGAAGG + Intergenic
1159381720 18:67668661-67668683 AAGACAAATGAGAGAAATGGTGG - Intergenic
1159728551 18:71995054-71995076 CAGAAGGAAGAGAAAGATGGGGG + Intergenic
1159833220 18:73303948-73303970 GAGAAAAAAGAGAAAAATGATGG + Intergenic
1160029346 18:75244961-75244983 CAGACAAGAGAGAGAGATGGGGG - Intronic
1160290977 18:77593325-77593347 CAGAGAAAATGGAAAGTTGGAGG - Intergenic
1160611375 18:80089477-80089499 CAAAGAAAAGAAAAAAATTGGGG - Intronic
1161369153 19:3900174-3900196 GAGAGAAAAGAAAAAAAAAGAGG - Intronic
1161459987 19:4390807-4390829 CTTGGAAAAGAGAAACATGGAGG + Intronic
1162473515 19:10886500-10886522 AAGATAAAAGATAAAAATGAGGG - Intronic
1163214608 19:15866730-15866752 CAGAGAAAAGGGAACACTGCTGG - Intergenic
1163339282 19:16694238-16694260 CAGCGAAAAAAAAAAAAAGGCGG + Intergenic
1163508877 19:17723856-17723878 CAAAAAAAAGAAGAAAATGGTGG + Intronic
1163560424 19:18016178-18016200 AAGAGAAAAGAAAAGAAAGGGGG + Intergenic
1163839265 19:19595890-19595912 CTGGGAAGAGAGAAAAATAGTGG + Intronic
1164250061 19:23468323-23468345 GAAAGAAAAGAGAAAAAGGAGGG - Intergenic
1164252688 19:23495982-23496004 CAAAAAAAAGAAAAAAATGCTGG + Intergenic
1164476696 19:28581021-28581043 CAAAAAAAAAAAAAAAATGGTGG - Intergenic
1164550890 19:29211786-29211808 CAGAGTAAAAAGAAAAGTGGCGG + Intronic
1164610731 19:29629851-29629873 AAAAGAAAAAAGAAAAATGAAGG + Intergenic
1165037350 19:33043241-33043263 CTGAAAAAAAAGAAAAAAGGTGG + Intronic
1165103282 19:33452888-33452910 CAGAAAACAGAAAAACATGGGGG + Intronic
1165366347 19:35369141-35369163 CAGTGAAAAAAGAAAACTGTAGG + Intergenic
1165439479 19:35816445-35816467 CAGTGAAAAGACAAAGAGGGAGG - Intergenic
1165585134 19:36908490-36908512 AGGAGAAAAGAAAAAGATGGCGG + Intronic
1166264013 19:41665762-41665784 AAAAGAAAAGAAAAAGATGGGGG + Intronic
1166619191 19:44280459-44280481 AAAAGAAAAGAAAAAAAAGGGGG + Intronic
1166772486 19:45292271-45292293 CTTAAAAAAGAGAAAAAGGGTGG + Intronic
1167552845 19:50173059-50173081 AAGAGAAAAGGAAAAAAGGGAGG + Intergenic
1167635726 19:50654277-50654299 GAAAGAAAAGAGAGAGATGGAGG - Intronic
1167905608 19:52658180-52658202 CAAAGAATAAAGAAAAATGAAGG + Intronic
1168071900 19:53958214-53958236 AAGAGAAAAGAAAAAATTGTTGG + Intergenic
1168175844 19:54627086-54627108 CAGAACAAAGCAAAAAATGGAGG - Intronic
1168268108 19:55233941-55233963 CACAGAAAAAAGAAAATGGGAGG - Intronic
1202669096 1_KI270709v1_random:33577-33599 TAGAGAACAGAGAAAAAAGTAGG + Intergenic
925271503 2:2612700-2612722 CATAGAAGAGAGTAGAATGGTGG + Intergenic
925381925 2:3434378-3434400 CATATGAAAGAGAAAAATGTAGG - Intronic
925666349 2:6260551-6260573 AAGAGAAAATACAAAATTGGGGG + Intergenic
925678693 2:6394143-6394165 CATAAGAAAGGGAAAAATGGAGG - Intergenic
925856683 2:8135723-8135745 TGGAGAAAAGAGAAACGTGGAGG + Intergenic
926334374 2:11852195-11852217 CACAGATATGAGAAGAATGGTGG + Intergenic
926497951 2:13615681-13615703 CAGACAAAAGAAAAAAATTAAGG - Intergenic
926902843 2:17774775-17774797 CAGAGAAAAAAAAAAAAATGGGG + Intronic
926935999 2:18087003-18087025 CAGAGACAGGAGGAAAATGCAGG - Intronic
927003577 2:18824777-18824799 CTGAGTAAATAGAAAAAGGGAGG + Intergenic
927399211 2:22691270-22691292 CAGAAAAAGAAGAAAAAGGGAGG + Intergenic
927731174 2:25473096-25473118 CAAAGAAAAGACTAAATTGGGGG + Intronic
928039552 2:27861266-27861288 CACAGAAAAGAGACAAAGGGAGG - Intronic
928254152 2:29707430-29707452 CAGGGAAAACAGAACAAGGGAGG + Intronic
928296910 2:30091574-30091596 CAGAAAAACAAGAAAAAAGGGGG + Intergenic
928377971 2:30791977-30791999 CAGGGAAAAGAGAGAAACCGGGG - Intronic
928489525 2:31767096-31767118 CAAGGAAAAGAGTAAAGTGGAGG - Intergenic
928845932 2:35672188-35672210 CAGACAAAAGAAAGAAATGAAGG - Intergenic
928859094 2:35834253-35834275 CAGAGATAAAAGAAAAAAGATGG + Intergenic
929731616 2:44500660-44500682 CTGAGAAAAGGGCAAAATGCTGG - Intronic
929738044 2:44572173-44572195 CAGAGACAAAAGTAGAATGGTGG - Intronic
929795814 2:45057701-45057723 AAGAGCAAAGAGGAAAAAGGGGG - Intergenic
929837135 2:45413526-45413548 GAGAGAAAAGAGGAAAATGTAGG + Intronic
929902558 2:46018159-46018181 GAGAGAAAGGAGGAAAAAGGGGG + Intronic
930348282 2:50215015-50215037 CACAGAAATGAGACAGATGGCGG + Intronic
930389673 2:50745417-50745439 CAATGGAAAGAGAAAAAGGGAGG - Intronic
930423399 2:51181632-51181654 CAGAGAAAAGAAAGAAATAAAGG + Intergenic
930546177 2:52769948-52769970 AAGAGAAAACAGAAAAACGCAGG + Intergenic
930590572 2:53321973-53321995 CAGAGTAAAGAGAAGAAGTGTGG - Intergenic
930740612 2:54828997-54829019 GAGAGAAAAGACAACTATGGAGG - Intronic
931151685 2:59581136-59581158 AAGATAAAAGGGAAACATGGGGG - Intergenic
931328954 2:61259384-61259406 CAAAAAAAAAAGAAACATGGAGG - Intronic
931592355 2:63898978-63899000 TAGGAAAAAGAGCAAAATGGAGG - Intronic
931631155 2:64301017-64301039 AAGAGAGAAGAGAGAAATAGGGG + Intergenic
931784987 2:65610562-65610584 CAGGGAAGACAGACAAATGGAGG - Intergenic
931835033 2:66090133-66090155 CAAAGCAAAGAAAAACATGGGGG + Intergenic
931853795 2:66280652-66280674 CAGAGAAATGAAAAGACTGGAGG - Intergenic
931992582 2:67805443-67805465 GAAAGAAAGCAGAAAAATGGGGG + Intergenic
932289779 2:70567048-70567070 CAGAGAAACAAGAACAATAGGGG - Intergenic
932297163 2:70635589-70635611 CATAGAAGAGAGTAGAATGGTGG + Intronic
932375998 2:71236284-71236306 CTAAGAAAAGAGAAGAATGGCGG + Intergenic
932463575 2:71898681-71898703 AAGAGCAAAGAGATAAAGGGAGG - Intergenic
932502701 2:72197979-72198001 CAGAGCAAAGAGGAGAATGTTGG + Intronic
932942754 2:76188293-76188315 CAAAGAAAAAAGAAAAATTTTGG - Intergenic
933086188 2:78057470-78057492 CATAGAAAAAAGAACCATGGAGG - Intergenic
933209561 2:79551299-79551321 AAGAGGAAATGGAAAAATGGGGG + Intronic
933942377 2:87255127-87255149 CAGAGAGCAGAGGAAAATGGAGG - Intergenic
934250269 2:90346464-90346486 TAGAGAAAAGACAAATATGTAGG + Intergenic
934257242 2:91436655-91436677 TAGAGAACAGAGAAAAAAGTAGG + Intergenic
934259296 2:91456952-91456974 TAGAGAAAAGACAAATATGTAGG - Intergenic
934490430 2:94758825-94758847 CAGAGGAAAGAGCAAAATTAAGG + Intergenic
934621384 2:95810631-95810653 CAAAGAAATAAGATAAATGGTGG - Intergenic
934724525 2:96607087-96607109 CAGAGAAGGGAGAAAAAGAGAGG + Intronic
934812058 2:97288183-97288205 CAAAGAAATAAGATAAATGGTGG + Intergenic
934825635 2:97419744-97419766 CAAAGAAATAAGATAAATGGTGG - Intergenic
935208030 2:100913636-100913658 CAGTAAAAAGAGAAAAGAGGGGG - Intronic
935278382 2:101495911-101495933 AAAAGAAAAGAAAAACATGGCGG - Intergenic
935391465 2:102557761-102557783 AAGAGACAAGAAAAAAATGTGGG + Intergenic
935400320 2:102653601-102653623 CAGGGAAAAGAGAGAAAGGAAGG - Intronic
935447252 2:103169686-103169708 CAGAGAGACTTGAAAAATGGGGG - Intergenic
935579389 2:104743704-104743726 GAGAGAAAAGGCAAAAACGGTGG + Intergenic
935729272 2:106051661-106051683 CAGAGAGAAGAGAAAGCAGGTGG + Intergenic
935930593 2:108120281-108120303 AAGAAAGAAAAGAAAAATGGTGG - Intergenic
936337849 2:111606442-111606464 CAGAGAGCAGAGGAAAATGGAGG + Intergenic
936407123 2:112214725-112214747 CAGAGGAAAGGGGAGAATGGAGG + Exonic
936709267 2:115112673-115112695 GAAAGTAAAGAGTAAAATGGTGG + Intronic
937503121 2:122505081-122505103 CTGAGAAGGGAGAGAAATGGAGG - Intergenic
937554997 2:123143165-123143187 CAGTGGCAAGAGAAAAATGACGG - Intergenic
937585180 2:123538283-123538305 CAGAGGAAATATAAAAATTGAGG - Intergenic
937607511 2:123819172-123819194 CAGATAGAAAAGACAAATGGTGG - Intergenic
937677759 2:124610366-124610388 CAGTGAAATGAGAATAATAGTGG + Intronic
937732153 2:125246069-125246091 AAAAGAAAAGAGATAAATGTGGG - Intergenic
937753000 2:125500352-125500374 TAGAGAAAAGGGAACACTGGTGG - Intergenic
938287984 2:130134574-130134596 CAGAGAGAAGAGAAAGAGGAAGG - Intergenic
938427604 2:131204303-131204325 CAGAGAGAAGAGAAAGAGGAAGG + Intronic
938468541 2:131538325-131538347 CAGAGAGAAGAGAAAGAGGAAGG + Intergenic
938620321 2:133045456-133045478 CAGATCAAAGAGAAACATGAAGG + Intronic
938784561 2:134614024-134614046 CAGAGAAAGAAGAAAAAGGTAGG + Intronic
938912014 2:135894537-135894559 TAGAGAAATGAAAAAAATAGTGG - Intergenic
938993952 2:136657976-136657998 CAGGAAATAGAGAAAAGTGGAGG + Intergenic
939011590 2:136853326-136853348 GAGAGATAAGAGAAATATGGAGG - Intronic
939083869 2:137693996-137694018 CAAAGAAAAGAAAAAAATTAAGG + Intergenic
939538678 2:143465134-143465156 CAGAGAAAATAAAAAACAGGAGG - Intronic
939685156 2:145189915-145189937 GAGAGAAGAGAGATAAATTGAGG + Intergenic
939790164 2:146562400-146562422 AAGTGAAAAGAGAAAAAAGAAGG + Intergenic
939800096 2:146697836-146697858 CAGAGCAATTAGAAAAAAGGTGG + Intergenic
939941487 2:148356876-148356898 AAAAGAAAAGAGAAAAAATGTGG - Intronic
939992198 2:148886310-148886332 CAGAGAGGAGAGAAAAAAGTCGG - Intronic
940085108 2:149850439-149850461 CAGAGAAAAGAAAAACAAGGAGG + Intergenic
940157985 2:150679435-150679457 GAGAGGAAAGAGATAAATTGAGG + Intergenic
940259500 2:151765569-151765591 AAGGGAAAAGGGAAAAGTGGAGG + Intergenic
940728079 2:157358185-157358207 CAGAGAAGTGAGAAAAAGGATGG + Intergenic
940784388 2:157966633-157966655 CAGACAAAAGAGAGAAATAAAGG - Intronic
940787740 2:158000500-158000522 GAGAGAAAAGGGATAGATGGAGG - Intronic
941137813 2:161739232-161739254 CAGATTAACCAGAAAAATGGAGG + Intronic
941143230 2:161811429-161811451 AGGAGAAAATGGAAAAATGGAGG - Intronic
941258951 2:163272262-163272284 CAGAGACAGGAGAAAAAGTGTGG - Intergenic
941349553 2:164414989-164415011 CAGAGAAGAGAGGAAAATGTGGG - Intergenic
941404026 2:165066689-165066711 TAGAGAAAACAGAAAAAGGAAGG + Intergenic
941411691 2:165165194-165165216 GAAAGAAGAGAGAGAAATGGGGG - Intronic
941433318 2:165437122-165437144 AAGAGAAAAGATAAAAGTGTGGG - Intergenic
941486952 2:166093773-166093795 AAAACAAAAGAAAAAAATGGAGG + Intronic
941574333 2:167211981-167212003 GAGAGAAAAGCCAAAAAAGGTGG + Intronic
941627781 2:167848750-167848772 CAGACAAAAGAAAGAAATGAAGG + Intergenic
941705569 2:168655218-168655240 AAAAGAAAAGAGAGAAATGTTGG + Intronic
942022499 2:171880740-171880762 TAGAGAAAATAGAATAATGATGG - Intronic
942158908 2:173161408-173161430 CAGTGAGAAGAGTAAAATGCCGG - Intronic
942305542 2:174603622-174603644 CACAGGAAAGAGATAAATGTAGG + Intronic
942346358 2:175006271-175006293 CAGAGAAACAAGAAAAAAGAAGG - Intergenic
942391393 2:175497399-175497421 CTGAGAAAAAAGAAAATTGGAGG - Intergenic
942465676 2:176205089-176205111 CAGAAACAGGAGAAACATGGGGG + Intergenic
942485038 2:176429942-176429964 AAAAGAAAAGAAAAAGATGGGGG + Intergenic
942494663 2:176527121-176527143 CAGAGAAAAGAGGAAAAAGGAGG - Intergenic
942497158 2:176551876-176551898 CAGATAGAAGAAAAAGATGGAGG + Intergenic
942710008 2:178823168-178823190 CAGAGAAAAAATAATCATGGTGG - Intronic
942739065 2:179152888-179152910 CAAAGAAAATAGAAGAAAGGAGG + Intronic
942782982 2:179668286-179668308 TAGAGAAAAGGGAAAAATTAAGG - Intronic
942932529 2:181512931-181512953 CAGGGAAAAGAATAAATTGGAGG + Intronic
942981696 2:182091718-182091740 CAGAGAAAAGAAAAACAAGCAGG - Intronic
943204905 2:184882109-184882131 AAGAGAAAACAGAAAAAAGCAGG + Intronic
943456431 2:188113268-188113290 GAGAAATAAGAGAAAAATAGTGG + Intergenic
943501912 2:188701584-188701606 CAGAGAAAAAAGAAAAACATTGG + Intergenic
943544679 2:189259949-189259971 CATAGAAAAGAGAAAGAAGAGGG + Intergenic
943676032 2:190717270-190717292 CAGAGCAACAAGAAAAATGCCGG - Intergenic
943746878 2:191471421-191471443 AAGAGAAAAGAAAAATATTGAGG - Intergenic
943812153 2:192200514-192200536 AAGAAAAAATAGAAAAATGGAGG + Intergenic
943826525 2:192401157-192401179 CAGAGAAAAAAAAAAAAAAGAGG - Intergenic
943856089 2:192793298-192793320 CAGAAAAAATAGTAATATGGAGG - Intergenic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944327336 2:198421935-198421957 CAAAGAGCAGAGATAAATGGTGG + Intronic
944347635 2:198687095-198687117 AAAAGAAAAGAAAAAAATAGGGG + Intergenic
944359110 2:198830756-198830778 GAGAGAATAGAAAAAAATGATGG - Intergenic
944916481 2:204365746-204365768 AAGCAAAAAGAGAAAAAAGGAGG + Intergenic
945015674 2:205512875-205512897 AAAACAAAAGAGAAAAAAGGAGG - Intronic
945147515 2:206753747-206753769 AGCAGAAAAAAGAAAAATGGAGG - Intronic
945225817 2:207530296-207530318 CAGCGAACAAAGAATAATGGCGG + Intronic
945472179 2:210239785-210239807 GAAAGAAAAGAGAAAAAGAGAGG - Intergenic
945527483 2:210906056-210906078 CAGAGAAAATAGAAAATAGAGGG + Intergenic
945555968 2:211276388-211276410 CAGAGGGAAGAGAAACATTGTGG - Intergenic
945986587 2:216359353-216359375 CAGAGAAAAGAGAAAAGAAGAGG - Intronic
946144427 2:217718339-217718361 CAGAGAGAGGAGAAGAAGGGAGG - Intronic
946157436 2:217816252-217816274 CAAAGAAAACACAAAAAGGGAGG + Intronic
946276666 2:218636747-218636769 GGAAGAAAAGAGAAAAAAGGTGG - Exonic
946538230 2:220655418-220655440 CAGAGAAAAGAGAATAATTCTGG + Intergenic
946637449 2:221745097-221745119 CAAAGAAAAGAGAAAAAAGATGG + Intergenic
946647826 2:221857483-221857505 AAGAGAAAATAGAAAAATGAAGG + Intergenic
946730777 2:222707382-222707404 AAAAGAAAAGAGAAAGAGGGAGG + Intronic
946931181 2:224673061-224673083 CATAGAAAAAAGTAAAGTGGTGG + Intergenic
946952043 2:224886924-224886946 CACAAAAAATACAAAAATGGTGG - Intronic
947057653 2:226124874-226124896 AAGAGAAAAGAAAAATATGAGGG - Intergenic
947249616 2:228087090-228087112 CAGCCAAAAAAGAAAGATGGAGG + Intronic
947276584 2:228398307-228398329 CAGTGAAAAAAGAAAACTGCAGG - Intergenic
947282497 2:228470931-228470953 GAGAGAATAGAGAAAGATGGGGG - Intergenic
947374285 2:229480064-229480086 CAGAAAAAATAGAAGAATGCAGG + Intronic
947478333 2:230472646-230472668 AAAAGATGAGAGAAAAATGGAGG + Intronic
947776426 2:232714700-232714722 CACAGAAAACAGAACAGTGGTGG - Intronic
947898947 2:233703880-233703902 AAAAGAAAAGAAAAAAATGATGG - Intronic
948194543 2:236085593-236085615 GAGAGAAATGAGAAAAAAGAAGG - Intronic
949030173 2:241791978-241792000 AAAAGAAAACAGAAAAATGGGGG - Intronic
1169158778 20:3358135-3358157 CAGATAAAGTAGAAAAATGCAGG - Intronic
1169381950 20:5115125-5115147 CAGAGAATAGAGAAAAAAATAGG + Exonic
1169515005 20:6306764-6306786 AAGAGAAAAAAGAAAAAAGAAGG - Intergenic
1169518874 20:6350051-6350073 AAAAGAAAAGAAAAAAATTGGGG - Intergenic
1169913367 20:10665182-10665204 AAGGAAAAAGAGAAAAAGGGAGG + Intronic
1170160965 20:13310619-13310641 CAGAGTAAAGAGAAAAATTATGG + Intergenic
1170218174 20:13914252-13914274 CTGAGTAAAGTGAAAAATTGAGG + Intronic
1170235127 20:14094899-14094921 GGGAGAAATGAGAAAAACGGTGG - Intronic
1170402326 20:16001367-16001389 AAGAAAAAAGAGAAAAAGGGAGG + Intronic
1170404973 20:16026302-16026324 CAGTGAATACAGTAAAATGGTGG - Intronic
1170441698 20:16385934-16385956 CAGAGAAGAGATTAAAATTGTGG - Intronic
1170666021 20:18386703-18386725 GAAAGAGAATAGAAAAATGGAGG + Intronic
1170750218 20:19138749-19138771 CAGAGATAATTGAAACATGGAGG - Intergenic
1171293465 20:23995751-23995773 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1171378103 20:24708983-24709005 GAGGGAAAAGGGAAACATGGGGG + Intergenic
1171534999 20:25879650-25879672 CTGTGAAAATACAAAAATGGTGG - Intergenic
1171565115 20:26176017-26176039 TATAGTAAAAAGAAAAATGGTGG + Intergenic
1171568999 20:26227952-26227974 AAGAGAAAAGGGATGAATGGTGG - Intergenic
1171572890 20:26270306-26270328 CTGTGAAAATACAAAAATGGTGG + Intergenic
1171806075 20:29681287-29681309 CCGTGAAAATACAAAAATGGTGG + Intergenic
1171837985 20:30175134-30175156 CTGTGAAAATACAAAAATGGTGG - Intergenic
1171972626 20:31573500-31573522 AAGAGAAAAGGGAAAAAGAGCGG - Intronic
1172452586 20:35038028-35038050 CAGAGAAAAAAGCAGAATGGTGG + Intronic
1172603726 20:36200830-36200852 CAGAGGAAAGGGAAAGAGGGAGG - Intronic
1172771207 20:37383717-37383739 GAAAGAAAAGAAAAAAATGGGGG - Intronic
1172833506 20:37856864-37856886 CAGAAAAATAAGGAAAATGGAGG - Intronic
1172900689 20:38332377-38332399 CAGGCAGAAGAGAAAGATGGTGG + Intronic
1173051610 20:39567736-39567758 CAGAAAAAAGAGAGAGAGGGGGG - Intergenic
1173069535 20:39749182-39749204 AAGAGAAAATAGAAAGATGAAGG - Intergenic
1173089043 20:39952646-39952668 CAGAGAAAAGAAAGAAATGACGG + Intergenic
1173131233 20:40395616-40395638 GAGAGAAAACAGAAGATTGGAGG + Intergenic
1173233589 20:41222556-41222578 CAGAGAAACTACAGAAATGGGGG + Intronic
1173283679 20:41651600-41651622 GAGAGAAGAGAAGAAAATGGTGG - Intergenic
1173322453 20:42000633-42000655 CACAGAAAACATAAAAATGCAGG - Intergenic
1173899791 20:46579132-46579154 AAGAAAAAAAAGAAAAATCGAGG - Intronic
1174447329 20:50598904-50598926 CAGAAAAAAAAAAAAAAAGGAGG + Intronic
1174589446 20:51633762-51633784 AAGAGAAAAGAAAAAAAGGGAGG + Intronic
1175009775 20:55723553-55723575 CAGGGCAAAAAGAAAAATTGTGG + Intergenic
1175055572 20:56194415-56194437 CTGAGAAAAAAGAAAAAAGAGGG - Intergenic
1175381855 20:58569058-58569080 CAGAGAAAAAAAAAAAAGGTTGG - Intergenic
1175475642 20:59272012-59272034 GAGAGAAAAGGGAGAAGTGGGGG + Intergenic
1175512368 20:59539100-59539122 CAGGGAAAAGAAAAAAATAAAGG - Intergenic
1175512979 20:59547159-59547181 AATAGAAATAAGAAAAATGGTGG + Intergenic
1175742258 20:61427984-61428006 CAGAGAAAAGAGAACTACTGAGG + Intronic
1176511896 21:7755097-7755119 CAGAGAAAAAAGATAACTGAAGG + Intronic
1176585012 21:8574536-8574558 TAGAGAAAAGACAAATATGTAGG - Intergenic
1177300046 21:19231986-19232008 CAGTGACAAGAAAAAAATAGAGG - Intergenic
1177306920 21:19330697-19330719 ACGAGAAAAGACAGAAATGGTGG - Intergenic
1177467150 21:21500228-21500250 GAGAAAAAAGAGAAAAATCATGG - Intronic
1177493446 21:21857915-21857937 TAGAGAATAGTGACAAATGGGGG + Intergenic
1177518476 21:22186390-22186412 CAGAGGAAAGAGGTAAATGGAGG - Intergenic
1177732995 21:25053112-25053134 CAGAGAATAGAATAGAATGGTGG + Intergenic
1177796272 21:25781551-25781573 AAGAGAAGAGAGAGAAATGGAGG + Intergenic
1178197386 21:30362933-30362955 CAGAGAAAAGGGAACACTGTTGG + Intronic
1178261974 21:31107904-31107926 CTCAGAAAATAGAAAAATGTGGG - Intergenic
1178365908 21:31988636-31988658 GAGAAAAGAGAGAAAAATGAGGG - Intronic
1178376539 21:32072246-32072268 CAGAAAAAAGGGGAGAATGGAGG - Intergenic
1178389298 21:32185324-32185346 AAGAGGGAAGAGAAAAATGCTGG - Intergenic
1178445454 21:32637388-32637410 AAAAGAAAAAAGAAAAATTGAGG - Intronic
1178452086 21:32711304-32711326 CAGAAAAAAGAAAAAGGTGGAGG - Intronic
1178587036 21:33879350-33879372 CAGAAAAAAAAGAAAGATTGAGG + Intronic
1178646009 21:34385623-34385645 CAGAGAAAAAAGATAACTGAAGG + Exonic
1178965889 21:37117341-37117363 CAAATAAAAGACAAAACTGGTGG + Intronic
1178979307 21:37248424-37248446 CAGAAATACTAGAAAAATGGAGG + Intronic
1179222296 21:39419158-39419180 CAGAGACAGGAGAAGAATAGTGG - Intronic
1179373064 21:40824801-40824823 AGGAGAAAAGAGGAAAATGAGGG - Intronic
1179387407 21:40956158-40956180 AAGAGAGAATAGAGAAATGGAGG - Intergenic
1179592598 21:42419325-42419347 GAGAGGAAAGAGATAAATTGAGG - Intronic
1180178425 21:46103887-46103909 GAGGAAAAAGAGAAAAATGAAGG - Intronic
1180202049 21:46229760-46229782 CAGAGGGAAGAGGAAGATGGAGG + Intergenic
1180267821 22:10551438-10551460 TAGAGAAAAGACAAATATGTAGG - Intergenic
1180281929 22:10707695-10707717 AAGAGAAAAGGGATGAATGGTGG + Intergenic
1180454577 22:15501376-15501398 CAGACAAAAGAAAGAAATAGAGG - Intergenic
1180574369 22:16759200-16759222 CTGTGAAAATACAAAAATGGTGG - Intergenic
1180824521 22:18853467-18853489 CAAAGAAAACAGAAGCATGGAGG - Intronic
1181101461 22:20543091-20543113 CAAAGAAGAGAGAGAAATTGAGG - Intronic
1181124943 22:20696622-20696644 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181188214 22:21121081-21121103 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181210982 22:21289412-21289434 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181398518 22:22637476-22637498 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181540818 22:23572445-23572467 CAGAAAAAAGAAAGAAATGATGG + Intergenic
1181650897 22:24258584-24258606 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181706484 22:24652155-24652177 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181785349 22:25222573-25222595 CACAGAAAAATGAAAAATGGGGG + Intronic
1181963789 22:26642538-26642560 GAGAGAGAAGAGAAAAATGGAGG + Intergenic
1182001687 22:26925322-26925344 AAGTGCACAGAGAAAAATGGGGG + Intergenic
1182050170 22:27306639-27306661 CAGAAAAAAGAGAGAAACTGAGG - Intergenic
1182114114 22:27745127-27745149 AAAAAAAAAAAGAAAAATGGAGG + Intergenic
1182290279 22:29272149-29272171 CAAGGAGAAGAGAAAAAAGGGGG - Intronic
1182350534 22:29696790-29696812 CAGAAAAAAAAAAAAAACGGAGG - Exonic
1182957404 22:34439525-34439547 CAGGGTAGAGAGAAAAATGTGGG - Intergenic
1183292160 22:37009604-37009626 CAGAGGTCAGAGAAAAATGGTGG - Intergenic
1183728264 22:39601532-39601554 CAGAGGAGAGAGAAAAAGGCTGG + Intronic
1183753262 22:39734748-39734770 CAGAGATTAGTTAAAAATGGGGG - Intergenic
1183759636 22:39804532-39804554 AAGAGAAAAGAGCAAAAGGTTGG - Intronic
1183912278 22:41088901-41088923 CAAAGAAATGAGAAATGTGGAGG - Intergenic
1184346430 22:43916397-43916419 CAAAAAAAAAAAAAAAATGGTGG - Intergenic
1184542461 22:45136186-45136208 CATTTAAAAGAGAAAAATGTAGG + Intergenic
1184641119 22:45870798-45870820 CAGAGAAAAGAGAGTTATGCAGG + Intergenic
1184958200 22:47906944-47906966 AATAGAAAATAGAAGAATGGGGG + Intergenic
1184971658 22:48026567-48026589 TAAAGAAAAGAGAAAAAAGAAGG - Intergenic
1185360138 22:50401631-50401653 AAAAGAAAAAAGAAAAAGGGAGG - Intronic
1203215964 22_KI270731v1_random:6018-6040 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1203239170 22_KI270732v1_random:38858-38880 AAGAGAAAAGAGATGAATGGTGG + Intergenic
1203274659 22_KI270734v1_random:79372-79394 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1203325548 22_KI270738v1_random:11774-11796 TAGAGAACAGAGAAAAAAGTAGG - Intergenic
949166311 3:945700-945722 CAGAGCAAAGACAAGAATGCTGG + Intergenic
949233164 3:1775231-1775253 GAGAGGAAAGAGATAAATTGAGG - Intergenic
949456297 3:4242723-4242745 CAGCAAAAAGAGAAAAATTTAGG - Intronic
949690706 3:6634558-6634580 TATAGAAAAGTGAAAAATGAAGG - Intergenic
949725768 3:7042515-7042537 CAGAGAAAAAGAAAGAATGGGGG - Intronic
949930116 3:9071732-9071754 GAGGGAAAAGGGTAAAATGGGGG + Intronic
950366280 3:12486715-12486737 CAGGGAAAAGTGGGAAATGGGGG - Intronic
950366909 3:12492930-12492952 CTGAGGAAAGAGAGGAATGGGGG - Intronic
950383593 3:12638037-12638059 CTGAGTAAAGAGAAGAATGATGG - Intronic
950398895 3:12755098-12755120 AAAAGAAAAAAGAAAAAAGGAGG - Intronic
951043170 3:18010732-18010754 AAGAGAAAAGGGCAAAATGAAGG + Intronic
951074077 3:18368030-18368052 CAAAGAAATAAGAAAAGTGGAGG - Intronic
951291741 3:20879087-20879109 CAGATAAAAGTGAATAATAGTGG - Intergenic
951328035 3:21329015-21329037 AAAAGAAAAAAAAAAAATGGAGG + Intergenic
951338052 3:21448414-21448436 CAAAGAAGGAAGAAAAATGGGGG + Intronic
951693708 3:25424111-25424133 AAGAGAAAAGAGCCAAATGAAGG + Intronic
951993078 3:28697730-28697752 TACACAAAAAAGAAAAATGGAGG - Intergenic
952008465 3:28871155-28871177 CAGACAAAAGAGAGAAATGAAGG - Intergenic
952013476 3:28929862-28929884 CAGAGAAAAGAGAAATTGAGTGG - Intergenic
952287583 3:31982972-31982994 TAAGGAAAAGAGAAAGATGGTGG - Intronic
953100760 3:39824293-39824315 CAGAGCAAAGAGAACAATGCTGG - Intronic
953483075 3:43269046-43269068 TAAAGAAAAAAGAAAAAAGGAGG + Intergenic
953536868 3:43783279-43783301 GAGAGAAAAGAGAGGTATGGGGG - Intergenic
953590830 3:44251856-44251878 AATAGAAAAGGGAAAAATGAAGG - Intronic
953685470 3:45074804-45074826 GAGAGAAAAGAGAAGAATCTGGG + Intergenic
954428963 3:50459088-50459110 CTGGGAAAAGAAAAACATGGAGG + Intronic
954511027 3:51125420-51125442 CAGAGGAAATAGAAAAATATAGG - Intronic
954849843 3:53590928-53590950 CATACATAAGAGAAAAATGCAGG - Intronic
955031430 3:55224544-55224566 CAGAGAATTGAGAAAAATAAAGG + Intergenic
955153301 3:56390450-56390472 CAGTGAAAAGCAAAAAAGGGCGG + Intronic
955187024 3:56724068-56724090 AAGAGAAAATAGAAAATTGTGGG + Intergenic
955446221 3:59013255-59013277 AAGAAAGAAGAGAAAAATGGAGG + Intronic
955735652 3:62035473-62035495 CAAATAAATGAGAAAAATGAAGG - Intronic
955755958 3:62225302-62225324 CAGAGAGAAGAGGAAAATTTTGG + Intronic
956182002 3:66526220-66526242 CAGAGTAAAAAAAAAAATTGGGG - Intergenic
956261689 3:67350196-67350218 CAGAAGCAAGAGAAAGATGGGGG - Intergenic
956325344 3:68046064-68046086 TGGAGATAAGAGAAAAATGAAGG - Intronic
956504054 3:69918796-69918818 CAGAGAAAAGAAAATAAGAGAGG - Intronic
956522952 3:70125759-70125781 GAGAAAAAAGAGAAAAATAAAGG - Intergenic
956539116 3:70314354-70314376 CATAGAAAAGAGACAAATTAAGG - Intergenic
956812445 3:72877051-72877073 CAGAGGAAGGCGAAAAAAGGTGG - Intergenic
956901201 3:73717690-73717712 AAGAGGACAGAGAACAATGGAGG - Intergenic
956987858 3:74724103-74724125 CAAAGAAAAGACAGAAATGAGGG - Intergenic
957109849 3:75940378-75940400 AAGAGAAAAGGGATGAATGGTGG + Intronic
957282325 3:78169775-78169797 AGGAGAAAAAAGAAAAAGGGGGG - Intergenic
957311841 3:78530285-78530307 CACAGAAGAGAGATAAATGATGG + Intergenic
957323693 3:78664787-78664809 CACAGCAAGGAGAAAAATGAGGG - Intronic
957520402 3:81311594-81311616 AAAAGAAAAAAGAAAAAGGGAGG + Intergenic
957612289 3:82483743-82483765 GAGAGAACAGAGAAAAAGGTAGG + Intergenic
957650636 3:82998089-82998111 AAGAAAAAAGAGTAGAATGGTGG + Intergenic
957794732 3:84988621-84988643 AAGATAAAAGAAAAAAAAGGAGG - Intronic
957825051 3:85430676-85430698 CAGAGAAAAGAAACAAAGAGGGG + Intronic
958074975 3:88664938-88664960 CAGTGAAAAGAAAAATATGCAGG - Intergenic
958155814 3:89754206-89754228 CTTAGAAAAGAAAAAAAGGGAGG + Intergenic
958466136 3:94461287-94461309 CAGAGAAACGTTAACAATGGAGG - Intergenic
958507921 3:95005347-95005369 GAGAGGGGAGAGAAAAATGGAGG - Intergenic
958514109 3:95090632-95090654 TAGAGAAGGGAGAAATATGGAGG + Intergenic
958523547 3:95223169-95223191 CAGAGAAGAGAGAAAAATAAAGG - Intergenic
958861347 3:99448508-99448530 CATAAAAAAGGGAAAAAAGGAGG - Intergenic
958879106 3:99649376-99649398 AAAAGAAAAGAAAAAAATAGAGG + Intronic
959258140 3:104040866-104040888 AAGAGACAAGAGGAAAAGGGAGG - Intergenic
959388204 3:105739732-105739754 CAGAGAGAAAAGAAAAGGGGTGG + Intronic
959390326 3:105764529-105764551 GAGAGAAAAGAGAACAGTGTTGG - Intronic
959434274 3:106294840-106294862 AAGAGAAAAAAGAAAGATGTGGG - Intergenic
959446585 3:106448043-106448065 AAGATAAAAGACAAAAATTGGGG - Intergenic
959469057 3:106726445-106726467 CATAGGATAGAGAAAAAGGGAGG + Intergenic
959550278 3:107647890-107647912 AAGAGGAAAGAGAAAAGTGATGG + Intronic
959763110 3:109992351-109992373 GAGAGAAAAAATAAAATTGGAGG - Intergenic
959967001 3:112367502-112367524 AAGAGAAAAAAGAAAAAAGAAGG - Intergenic
959977701 3:112480594-112480616 CACAAGACAGAGAAAAATGGGGG + Intronic
960045979 3:113199005-113199027 CAGAAAAGAGAGAGAAAGGGAGG - Intergenic
960074570 3:113470182-113470204 AAGAACAAAGAGATAAATGGTGG + Intronic
960170213 3:114452069-114452091 AAGAAAAAAGAAAAAAAAGGGGG + Intronic
960297547 3:115962248-115962270 CACATGAAAGAAAAAAATGGTGG - Intronic
960321496 3:116242197-116242219 CAGAAAGAAGGGAAAAATCGAGG + Intronic
960430968 3:117568158-117568180 GAAATAAAAGAAAAAAATGGAGG + Intergenic
960505126 3:118483804-118483826 CATAGCAAAGAGTGAAATGGAGG - Intergenic
960630104 3:119721713-119721735 GCAAGATAAGAGAAAAATGGAGG + Intronic
960638352 3:119805729-119805751 AAAAGAAAAGAAAAAAAAGGAGG + Intronic
961004559 3:123396157-123396179 AAAAGAAAAGAGAAGAAGGGAGG + Intronic
961032394 3:123618039-123618061 CAGAGCAAAGGGAAAAGTTGTGG - Intronic
961841385 3:129716144-129716166 CAAAGAAAAAAGAAAAAAAGTGG - Intronic
962304620 3:134274511-134274533 CAGACAAGAGAGAAAAAATGAGG - Intergenic
962581453 3:136801471-136801493 TAGACAAAAGAAAGAAATGGGGG - Intergenic
962623306 3:137199881-137199903 GAGAGAAAAGAGAAAAATTGAGG - Intergenic
962656923 3:137556402-137556424 CAGTGAAAAAAGAAAACTGCAGG + Intergenic
962681164 3:137801794-137801816 CAGAGAGAAGAGAGAAAGGTCGG - Intergenic
962749065 3:138419749-138419771 GAGGTAAAAGGGAAAAATGGAGG - Intergenic
962779689 3:138700585-138700607 AAGAAAAAAGAGATGAATGGGGG + Intronic
963204263 3:142616327-142616349 TAGAGAAAAAAGAATGATGGAGG + Intronic
963262223 3:143204505-143204527 CAGAGAAGAGTGAAAAATTGGGG - Intergenic
963277486 3:143347403-143347425 CAAAGGAAACAGATAAATGGAGG + Intronic
963379676 3:144512135-144512157 CAGAGATAAGAAAGAAATGGTGG - Intergenic
963428415 3:145162741-145162763 CAAACAAAAGATAAAATTGGAGG + Intergenic
963631327 3:147734054-147734076 CAGAGAGAAGAGAAAAAAGAAGG - Intergenic
963846591 3:150164950-150164972 AAGAAAAGAGAGAACAATGGTGG - Intergenic
963967701 3:151391455-151391477 CAGAAAAAAGAGAGAAACAGAGG - Intronic
964266998 3:154909667-154909689 CAGACAAAAGAGCAAAATAAAGG + Intergenic
964487235 3:157198614-157198636 AGGAGAAAATAGAAAAATGATGG - Intergenic
964511128 3:157453061-157453083 CAGATCAAAGAGAAAAAAAGAGG + Intronic
964518555 3:157539561-157539583 TGCAGAAAAGAGACAAATGGTGG + Intergenic
964806388 3:160614203-160614225 CTGAGAAAAGTTAAATATGGTGG - Intergenic
964988545 3:162775095-162775117 AAGAGAAAAGAAAAACAAGGGGG - Intergenic
965107978 3:164382940-164382962 TGGAGTAAAAAGAAAAATGGGGG + Intergenic
965140156 3:164822818-164822840 GACAGAAAAGAGTAAACTGGAGG - Intergenic
965147547 3:164926084-164926106 AACAGAAAAGAGAAAAAAGCAGG - Intergenic
965564559 3:170100124-170100146 CAAAGAGAAGAGAAAACTGGAGG + Intronic
965570671 3:170168824-170168846 TAGAGAAAAGAAAAGAATGCAGG + Intronic
965767783 3:172149470-172149492 GAAAGAAAAGAGAAAAGGGGTGG - Intronic
966055782 3:175687828-175687850 CAGAAACAAGAGAAAGGTGGGGG - Intronic
966108444 3:176364993-176365015 CAGAGAAAAGAGGAAAAAAAGGG + Intergenic
966141538 3:176762619-176762641 AAGAGAAAACAGAAAAAAAGGGG + Intergenic
966374948 3:179286852-179286874 CAGAGAAATGAGAAAGTTGGGGG + Intergenic
966445012 3:179992313-179992335 TACAGATAAGAGAAAAAAGGAGG + Intronic
966624945 3:182005717-182005739 CACAGAAAAGAGACAAAGTGAGG + Intergenic
966958564 3:184910093-184910115 CAAAGAAAAGAGAAAGAGGAAGG - Intronic
967137889 3:186528080-186528102 CACAGAAAAAAAAAAAATGTAGG + Intergenic
967500567 3:190192665-190192687 CAGAGAAAAGAGGAAAACCTGGG - Intergenic
967610292 3:191497886-191497908 CAGACACCAGAGAGAAATGGTGG - Intergenic
967655871 3:192047861-192047883 CAGACAAAAGAAAAAAATAAAGG + Intergenic
967687022 3:192429424-192429446 GAGAAATAAGAGAAAAATGTTGG - Intronic
967978905 3:195053567-195053589 AAGACAAAAGTGAAAAATAGGGG - Intergenic
968205726 3:196798329-196798351 AAGAGAAAAGAAAAAAAAGTTGG - Intronic
969481395 4:7448820-7448842 GAGGGAAAAGAGAGAAAGGGAGG - Intronic
969905589 4:10392009-10392031 CAGACAAGAGAAAAAAATAGGGG - Intergenic
970187050 4:13467697-13467719 CAGAGAAAGCAGAAAAAGAGGGG + Intronic
970290496 4:14565913-14565935 GAGAAAGAAGAGAAAAATGAAGG - Intergenic
970452838 4:16189168-16189190 CACATAAAAGAGAGAAAAGGAGG + Intronic
970753927 4:19400965-19400987 CAGAAAAAAAAAAAAAAGGGGGG - Intergenic
970873970 4:20848270-20848292 TAGAGAAGAGAAAAAAATAGAGG + Intronic
971107809 4:23545983-23546005 CAGAGAAAGAACAAAAAAGGGGG - Intergenic
971399733 4:26265010-26265032 CATAGGGAAGAGAAAAATAGGGG + Intronic
971509467 4:27406185-27406207 CAGAGAAAAATGTAAAATTGTGG + Intergenic
971551338 4:27960643-27960665 CAGAGCAGAGAAAAGAATGGTGG + Intergenic
971597092 4:28543974-28543996 TAGAGAAAAGTCAAAAAGGGAGG + Intergenic
971770626 4:30891610-30891632 CAGCTAAAAGAGAAAAATAGTGG - Intronic
971864815 4:32156016-32156038 CAAGGAAAAGAGACAAGTGGTGG - Intergenic
971938235 4:33181526-33181548 CAGAAAAAAGAAAAAAATAAAGG - Intergenic
971939320 4:33193757-33193779 CACAGAAAAGACAAAAATGTAGG - Intergenic
971961031 4:33487300-33487322 GAGGGAAAAGAGAAGAATGAGGG + Intergenic
972065005 4:34931123-34931145 TAGAGAAAAGAGTAGAATGGTGG + Intergenic
972504194 4:39705600-39705622 CAAAGGATAGATAAAAATGGTGG + Intronic
972550846 4:40133013-40133035 CACAGCAGAGGGAAAAATGGCGG - Intronic
972594235 4:40516149-40516171 GGGAAAAAAGAGAAAAAGGGAGG - Intronic
972696729 4:41453860-41453882 CAGAGAAATGAGATAAATGGAGG - Intronic
972770056 4:42189417-42189439 CAGAGAAAAGAGGATAAGGAGGG - Intergenic
973563344 4:52159094-52159116 AAGAGAAAAGAAAAGAAAGGAGG - Intergenic
973636521 4:52866203-52866225 AAGAGAAAAAAGAAAAAAGGGGG - Exonic
973884859 4:55310281-55310303 CAGTGAAAAGAGAAAAAAGCAGG + Intergenic
973942146 4:55922056-55922078 TAAGGAAAAGAGTAAAATGGGGG + Intergenic
974142287 4:57902550-57902572 GAGAGATAAAAGAAAAATTGTGG + Intergenic
974193900 4:58543872-58543894 CAGGGAAAAAGTAAAAATGGAGG + Intergenic
974425589 4:61739035-61739057 CTGAGAAATGACAAAAATGCTGG - Intronic
974582584 4:63823992-63824014 CACAGGAGAGAGTAAAATGGTGG - Intergenic
974745773 4:66073817-66073839 AAGAGAAAAGAGAAGAAAGCAGG - Intergenic
975153280 4:71044205-71044227 CAGAGAAGGAAGAAAAGTGGGGG + Intergenic
975304491 4:72833531-72833553 CTGAGAAAAGTAAGAAATGGGGG - Intergenic
975926531 4:79461733-79461755 GAGAGAAAAGAGAGATATGCAGG + Intergenic
976169321 4:82286489-82286511 TAGAAAGAGGAGAAAAATGGTGG + Intergenic
976263802 4:83171473-83171495 CTGAGTAAAAAGAAAGATGGTGG - Intergenic
976306137 4:83561129-83561151 TAGAGAAAACAGCACAATGGGGG + Intronic
976398349 4:84582110-84582132 AAGAGAAAAAAGAAAAAAGGCGG - Intergenic
976549949 4:86382225-86382247 CAGAGCAGAGAGACGAATGGAGG + Intronic
976660685 4:87537167-87537189 GAGAGGAAAGAGATAATTGGAGG - Intergenic
976738029 4:88330483-88330505 CACAGCAAAGAGAAAAATGCTGG - Intergenic
977080261 4:92518153-92518175 CAGAGAAAGAAAAAAAAAGGGGG - Intronic
977131768 4:93248520-93248542 CAGAGAAAGCAGAAAATTTGAGG - Intronic
977179379 4:93855292-93855314 CAGAGGAAAGACAAAAATTCCGG - Intergenic
977377798 4:96229359-96229381 CAGGGAAGGGAGAAAAATGGGGG + Intergenic
977377858 4:96230301-96230323 CAGAGAAGGAAGAAAAATGGTGG + Intergenic
977662950 4:99611951-99611973 AAGAGAAAAGAATAAAATGTAGG + Intronic
977739922 4:100467039-100467061 CAAAGAAAGGAGAAAAATAATGG + Intronic
977784812 4:101020460-101020482 CAGAAAAAGGAGATAAGTGGTGG - Intergenic
977845727 4:101764378-101764400 CAGAAAAAAGAGAGAAGTGTGGG - Intronic
977967948 4:103177417-103177439 AAGAGTCAAGAGAAGAATGGTGG - Intronic
978291885 4:107151784-107151806 CTGAGGAAAGTGAAAAACGGTGG + Intronic
978325116 4:107544890-107544912 CAGATGAAAAAGAAAAATGTTGG - Intergenic
978394020 4:108258648-108258670 CAGGGAAAAGAGGAACATGATGG + Intergenic
978782740 4:112574451-112574473 CACAGAAGAAAGAAAAATGCTGG + Intronic
978850666 4:113332107-113332129 CAGAAGAAGGAGAAGAATGGGGG - Intronic
979007572 4:115321269-115321291 TAGAGAAAAGCTAAAAGTGGTGG - Intergenic
979273166 4:118786297-118786319 AAGAAGAAAGAGAAAAATGTAGG - Intronic
979384063 4:120042865-120042887 CAGAAAAAACAGAAAAATGAAGG - Intergenic
979424857 4:120551715-120551737 GAGAGAAAAGAGAGAAAGGAAGG - Intergenic
979519568 4:121650852-121650874 AAGACAAAAGGGAAAAAAGGGGG - Intergenic
979617392 4:122759067-122759089 CAAAAAAAAAAAAAAAATGGGGG + Intergenic
979833531 4:125331069-125331091 AAGAGAAAAACGAAAACTGGAGG - Intronic
979857250 4:125650188-125650210 CAGAAAAAAAAAAAAAAAGGCGG - Intergenic
979900196 4:126206220-126206242 CAAAGAAAAGAGAATAAAGCTGG - Intergenic
979972389 4:127152244-127152266 CAGAAAATAAAGAAAAATGTAGG + Intergenic
980096027 4:128491788-128491810 TACAGAAAAGAGAAAAATGATGG - Intergenic
980445003 4:132893843-132893865 CAGAGGAAAAAGAGAACTGGAGG + Intergenic
980559838 4:134459071-134459093 CACAGAAAGGAGAAGAATGAAGG - Intergenic
980567072 4:134556438-134556460 AAGAGAAAAAAGAAAAAAGAAGG + Intergenic
980689014 4:136267571-136267593 CAGAAAAAAGGGAAAACTCGGGG + Intergenic
980847386 4:138340432-138340454 TGGAGAAAAGTGAAAAATGCTGG - Intergenic
981090449 4:140726819-140726841 CAAAGAATAGAGAAAAGTTGTGG - Intronic
981148992 4:141359495-141359517 CAAGGAAAAGATAAGAATGGAGG - Intergenic
981234674 4:142401226-142401248 CAGAGGAGAGAGAGAAGTGGAGG - Intronic
981569932 4:146141263-146141285 CAGACAACATAGAGAAATGGGGG + Intergenic
981588873 4:146334595-146334617 CATAGAAAAGAGGCAAAAGGGGG + Intronic
981624443 4:146739833-146739855 CAGAGAGAAGACAAATCTGGTGG - Intronic
981877963 4:149571445-149571467 CACAGTAGAGAGTAAAATGGTGG + Intergenic
982049029 4:151480834-151480856 TCGTGAAAAGAAAAAAATGGGGG - Intronic
982258640 4:153473884-153473906 CAGAGGTAAGGAAAAAATGGGGG + Exonic
982347546 4:154377614-154377636 CAAAGAAAGGAGAAAAGTGAAGG - Intronic
982372537 4:154649209-154649231 AATAGAAAAGAGAAAAAAGCAGG + Intronic
982405412 4:155014748-155014770 CAGAGATAAGAAAAAAATCAAGG - Intergenic
982662783 4:158226878-158226900 AAAAGAAAAGAAAAAAAGGGGGG - Intronic
982863576 4:160483009-160483031 GGGAGAAAAGAAAAACATGGCGG + Intergenic
982948727 4:161662654-161662676 GAGAAAACAGAAAAAAATGGAGG + Intronic
983154653 4:164331322-164331344 AAGAAAGAAAAGAAAAATGGTGG + Intronic
983211643 4:164964502-164964524 CTTTGAAAAGATAAAAATGGAGG + Intronic
983484407 4:168317415-168317437 AATGGAAAAGAGAAAAAAGGAGG + Intronic
983752498 4:171293558-171293580 AAGAAAAAGGAGTAAAATGGAGG + Intergenic
984022220 4:174499488-174499510 CATTGAAAAGAGAAACAAGGTGG - Intronic
984056364 4:174934089-174934111 CAGAGAAAAGGGAACACTGTTGG - Intronic
984405311 4:179321548-179321570 CAGAGAAAAAAGAAAAAGGAAGG - Intergenic
984413526 4:179427657-179427679 CACAGAGAAGAGAAAAAGGCTGG + Intergenic
984665030 4:182417806-182417828 CAAAGAAAATAGCAAAATGATGG - Intronic
984670974 4:182486972-182486994 AAGAGAAAAGAGAAAACAGGGGG - Intronic
984775571 4:183478929-183478951 AAAAGAAAAGAGAAAAACGCAGG - Intergenic
984888326 4:184470701-184470723 AAAAGAAAAGAAAAAAAAGGTGG + Intronic
985055261 4:186030542-186030564 CATGGAAAAGAGGAAAATGAAGG - Intergenic
985092505 4:186378528-186378550 CAGAGAAAAGAACATCATGGTGG - Intergenic
985436554 4:189936008-189936030 GATAGCAAAAAGAAAAATGGAGG - Intergenic
985837969 5:2284186-2284208 CTGGGAAAAGAAAGAAATGGTGG + Intergenic
986109236 5:4694885-4694907 AAGAAGAAAGAGAAAAAAGGGGG + Intergenic
986422873 5:7601696-7601718 CAGAGTGAAGAGAAGAATGAAGG - Intronic
986457507 5:7934006-7934028 AAGAGAAAAGAAGCAAATGGAGG + Intergenic
986924722 5:12732586-12732608 CAGAAGCAAGAGAAAAAAGGAGG + Intergenic
987038852 5:14043146-14043168 CAGTGAAAAAAGGAAAATGTTGG - Intergenic
987187595 5:15441016-15441038 CAGAGAAATAAGAGAAATGCTGG - Intergenic
987221823 5:15798363-15798385 CAAAGAAAAGGGGAAACTGGAGG - Intronic
987249303 5:16082049-16082071 CAGAGAAGAGAAAAAAATAATGG + Intronic
987319638 5:16756471-16756493 AAGAAAAAAGAGACAGATGGAGG - Intronic
987436296 5:17897707-17897729 GAGAAAGAAGAGAATAATGGTGG + Intergenic
987568163 5:19620526-19620548 GAGAGAAAAGAGAAATAAAGAGG + Intronic
987617705 5:20298006-20298028 AAGTGAAAATAGAATAATGGGGG - Intronic
987729244 5:21747047-21747069 CAGAGATAACAGAAAAACGCAGG + Intergenic
987776165 5:22369650-22369672 CTGAGATTAGAGTAAAATGGTGG - Intronic
987844578 5:23265915-23265937 CAAAGAAAACTGATAAATGGAGG - Intergenic
987879953 5:23730538-23730560 GAGAGAATAGAGAAAAAGTGAGG - Intergenic
988001204 5:25351467-25351489 AAGACAAAAGAGAAGACTGGAGG + Intergenic
988208267 5:28169040-28169062 CATAGAAAGGAATAAAATGGAGG - Intergenic
988216291 5:28277796-28277818 AAGAGAAAAGAGAGAGAGGGAGG - Intergenic
988229259 5:28452744-28452766 CAGAGAATAAAGGAAAATGAAGG + Intergenic
988351918 5:30119379-30119401 CAAAGAAATGACAAACATGGTGG - Intergenic
988965500 5:36412930-36412952 CAAAAAAAAGAAAAAATTGGAGG + Intergenic
988993230 5:36691255-36691277 CAGAGAAAAATTCAAAATGGGGG - Intergenic
989289640 5:39748252-39748274 AAGAAAAAAGAAAAAAATGAAGG - Intergenic
989702944 5:44292532-44292554 AAGAGAAATGAGAAATATGAGGG - Intergenic
989992228 5:50781087-50781109 TAGAGAAATGAAAAACATGGAGG - Intronic
990111023 5:52325003-52325025 AAGAGAAAAGACAAAAATTAAGG - Intergenic
990111796 5:52335603-52335625 AAGAGAAAATATAAAAATGGTGG + Intergenic
990193731 5:53290043-53290065 AAAACAAAAGAGAAAAATTGGGG - Intergenic
990228445 5:53684052-53684074 CAAAGAAAAGACAAAAATCAAGG + Intergenic
990396376 5:55384529-55384551 CATAGAACAGGGAAAAATGTAGG - Intronic
990397569 5:55399032-55399054 CAGAGAAAACACTAAAATTGCGG - Intronic
990457038 5:55998061-55998083 CACAGAATAGAGATAGATGGGGG - Intergenic
990533615 5:56698405-56698427 CAGAGTACAGAGAACAATGCTGG - Intergenic
990600972 5:57358359-57358381 GGGAGAAAAGACAAAAATGCAGG + Intergenic
990644639 5:57830470-57830492 CATAGAAAAGTGATAAATGATGG + Intergenic
990756015 5:59071321-59071343 TAGAAAAAAGAGAAAACTGCAGG - Intronic
990763099 5:59152278-59152300 CAAAGAAAATAATAAAATGGAGG + Intronic
990827488 5:59918046-59918068 CACAAAAAAGAGAAAATTTGTGG + Intronic
990999039 5:61764433-61764455 TGGAGACAAGAAAAAAATGGGGG + Intergenic
991037455 5:62142272-62142294 CAGAGAAAAGAAAACAAGGCAGG + Intergenic
991194983 5:63921991-63922013 AAAGGAAAAGAGAAAAATCGAGG + Intergenic
991245049 5:64501881-64501903 CAGAGAAGTGAAAAAAAGGGGGG - Intergenic
991304346 5:65160648-65160670 CAAAAAAAAAAAAAAAATGGAGG - Intronic
992197719 5:74356297-74356319 CAGAGAATAAAGAAAAAAGAAGG + Intergenic
992285920 5:75235776-75235798 AAGAAAAGAGAGAAAAAAGGGGG - Intronic
992519991 5:77540704-77540726 CAAAGAAAAGAAAAGAATGTAGG + Intronic
992804672 5:80324943-80324965 AAAAGAAGAGAGAAAAAAGGAGG - Intergenic
992885383 5:81153675-81153697 GAAAGCAAATAGAAAAATGGCGG + Intronic
992903771 5:81325056-81325078 CAGAGAAAAAAGAGAACTGATGG + Intergenic
992949827 5:81848164-81848186 CAGAGAAGTGAGGAAAAGGGAGG - Intergenic
993050943 5:82925136-82925158 CAGAGAAAGCAGGAAACTGGAGG - Intergenic
993260641 5:85654600-85654622 AGGAGAAGAGAGAAAAATGTGGG + Intergenic
993289084 5:86041531-86041553 CAGACAAAAGACAAAAATTAAGG - Intergenic
994155832 5:96503472-96503494 AAAAGAAAAGAGAAGAAAGGGGG + Intergenic
994330990 5:98506335-98506357 AATAAAAATGAGAAAAATGGAGG + Intergenic
994478360 5:100299780-100299802 AAGAGAAAAGAGATAAGTTGAGG + Intergenic
994613839 5:102078581-102078603 CAGAGGCAAGAGAAAAAAGTTGG + Intergenic
994679882 5:102873266-102873288 GAGGGGAAACAGAAAAATGGTGG - Intronic
995176017 5:109178029-109178051 AAGAGAATAGAGAGAAAAGGAGG + Intronic
995399212 5:111721443-111721465 CAGGGAAAAGAGAAAACAGGAGG + Intronic
995419197 5:111944306-111944328 CTCAAAAAAGAAAAAAATGGAGG - Intronic
995653868 5:114402661-114402683 GAGAGAAAGGGGAACAATGGCGG + Intronic
995824100 5:116273877-116273899 TACAGAAAAGAGAAAATTTGAGG + Intronic
995885771 5:116892485-116892507 CAAAAAAAAGAAAAAAAAGGTGG + Intergenic
996084747 5:119293382-119293404 CTCAGAAATGAGTAAAATGGAGG - Intronic
996166882 5:120235124-120235146 AATAGAAAATAGAAAAATGCAGG - Intergenic
996225789 5:120994554-120994576 CAGAAAAAAGAAAGAAATGAAGG + Intergenic
996353719 5:122574083-122574105 CAGAGCAAGAAGAAAAAAGGGGG + Intergenic
996437049 5:123445977-123445999 AAGAGAAAAGAAAAAAGGGGAGG + Intergenic
996506381 5:124272177-124272199 AAGAGAAAATAGAAGAAAGGAGG + Intergenic
996527663 5:124496743-124496765 AAGAGCAGAGATAAAAATGGGGG + Intergenic
996547903 5:124700101-124700123 CAGAGAACAAAGAAAAATGAAGG - Intronic
996670756 5:126114232-126114254 CAAATAAAAGAGGAAAATGTGGG - Intergenic
996748533 5:126866891-126866913 AAAAAAAAAGAGAAAATTGGTGG + Intergenic
996985734 5:129561541-129561563 AAAAAAAAAAAGAAAAATGGAGG + Intronic
997121483 5:131177809-131177831 GAGAGAAAAGAGAAAAGGGAGGG - Intronic
997460403 5:134047922-134047944 AAAAAAAAAGAGAAAAATGATGG - Intergenic
997533892 5:134600651-134600673 AAGAGAAGAGAGAAAGAGGGAGG + Intergenic
998019461 5:138757195-138757217 CAAACAAAAGAAAAAAAGGGAGG + Intronic
998019742 5:138759467-138759489 GAGGAAAAAGAGAAAAATGAAGG + Intronic
998140883 5:139698769-139698791 CACAGGAGAGAGAAAAGTGGAGG + Intergenic
998221248 5:140282399-140282421 CAAAAAAAAAAAAAAAATGGAGG - Intronic
998225315 5:140322403-140322425 CAAAAAAAAAAAAAAAATGGGGG - Intergenic
998270364 5:140700894-140700916 GAGAGAGAAAAGAAAGATGGTGG + Exonic
998400599 5:141846762-141846784 AAGAAAAAAGAAAAAAATGGAGG - Intergenic
998610141 5:143679771-143679793 CAGTGATAAGAGAAAACTGATGG + Intergenic
998770636 5:145540687-145540709 CAGAAAAAAAAAAAAAAAGGTGG + Intronic
998819246 5:146043168-146043190 CAGAGAAGAGAGAAACTGGGTGG - Intronic
999007791 5:148001838-148001860 GGGTGAAAAGAGAAAAATGGGGG - Intergenic
999416501 5:151401466-151401488 CTGAGCAAAAAGAAAAAAGGTGG - Intergenic
999542951 5:152593954-152593976 TAAAGAGAAGAGAAAAATTGGGG - Intergenic
999609983 5:153358725-153358747 CAAAGAAAAGAGAGGAATTGCGG - Intergenic
999632494 5:153585248-153585270 GAGAGAAGAGAGAGAAATGAGGG - Intronic
999758004 5:154679663-154679685 CAGAGAAGACAGACAGATGGTGG - Intergenic
999905968 5:156141621-156141643 CAGAGATACAAGATAAATGGGGG + Intronic
1000069192 5:157723271-157723293 CAAAAAAAAGAAAAAAAGGGGGG + Intergenic
1000616471 5:163433212-163433234 GAGAGAAAAGAGAAAAGGGTTGG + Intergenic
1000867229 5:166528712-166528734 AAGAAAAATGAGAAAAATGATGG + Intergenic
1001165270 5:169359799-169359821 CAGAGAAAAGGGAACACTGTTGG + Intergenic
1001592109 5:172872835-172872857 AAAAGAAAAGAAAAAAAAGGTGG + Intronic
1002301613 5:178260492-178260514 CAGTGAAAAGAGATCAGTGGTGG + Intronic
1002363274 5:178690472-178690494 CATAGAAGAGAGTAGAATGGTGG - Intergenic
1002899470 6:1398988-1399010 CAGAGAAAAGGCAAAGAAGGGGG + Intergenic
1003089202 6:3087320-3087342 GAAAGAAAAGAGAAAGAGGGTGG - Intronic
1003591180 6:7438138-7438160 TAAAGAAAAAAGAAAAAGGGAGG + Intergenic
1003642225 6:7885670-7885692 TGGAGAAAACATAAAAATGGAGG - Intronic
1003790704 6:9544201-9544223 CAGAGGAAACAGAAATAGGGTGG + Intergenic
1003908702 6:10724598-10724620 GACAGAGAAGAGAAAAATGCAGG + Exonic
1004049139 6:12057551-12057573 AACAGAAAACAGAACAATGGAGG - Intronic
1004073421 6:12323553-12323575 TAGAGAAAAGGGAAAAGTGCTGG - Intergenic
1004398973 6:15270953-15270975 GAGAGAAAAGAAAAAACTGTGGG + Intronic
1004893164 6:20121443-20121465 CAAAGAAAAGGGAAGCATGGGGG + Intronic
1004928536 6:20439524-20439546 AAGAGAAAAGAAAAAATGGGAGG - Intronic
1004943333 6:20584953-20584975 CAGAGAAAGCAGAAAACTGCAGG - Intronic
1005023115 6:21436546-21436568 CAGGGAGAAGAGAAGAATTGTGG - Intergenic
1005049677 6:21673309-21673331 GAGAGGAAAGAGGAATATGGCGG + Intergenic
1005088912 6:22035645-22035667 CAGAGCAAAGCTAAAAATGGTGG + Intergenic
1005261625 6:24067384-24067406 AAGAGAAAAGAGATAAATCAAGG + Intergenic
1005287511 6:24344146-24344168 CATAGAAGAAAAAAAAATGGTGG - Intronic
1005370326 6:25125218-25125240 CAGAAAAAAAAGCAAAGTGGAGG + Intergenic
1005436845 6:25821228-25821250 GAGAGAAAAAAGAAGAATGGAGG - Intronic
1005487000 6:26310085-26310107 CAGAGAAAAGAGCAAGAAGCGGG + Intergenic
1005579165 6:27217226-27217248 AAAAGAAAAAAGAAAAATGTCGG - Intergenic
1005631597 6:27713276-27713298 CAGAGAAAAGTGAAGACGGGTGG + Intergenic
1005845455 6:29773443-29773465 AATAAAAAAGAAAAAAATGGAGG - Intergenic
1006213166 6:32414587-32414609 GAAAGAAAAGAGAAGAAAGGAGG + Intergenic
1006221962 6:32498755-32498777 AAGAGAGAAGAGAGAAAGGGGGG + Intergenic
1006246825 6:32744422-32744444 CAGAGGAAAAAAAAAAGTGGGGG + Intronic
1006251941 6:32795011-32795033 TAGAGAAAAGTGAAAGATCGAGG - Intergenic
1006516648 6:34549276-34549298 CAGAGACAGGAGCAGAATGGTGG + Intronic
1006686554 6:35839634-35839656 CAGAGAGAAAAAAAAAAGGGGGG - Intronic
1007005257 6:38356369-38356391 TAGAGAAAATATAAAAATGCAGG - Intronic
1007436646 6:41817610-41817632 AAAAGAAAAAAGAAAAATGGTGG - Intronic
1008071135 6:47100304-47100326 CAGAGAACAAAGGAAGATGGAGG - Intergenic
1008137700 6:47795747-47795769 GAGAGAGAAGAGAGAAGTGGGGG - Intronic
1008197714 6:48545115-48545137 CAGAGGATAGAGAGTAATGGAGG + Intergenic
1008208484 6:48691546-48691568 CAGAGAAAAGAAACTAATAGAGG + Intergenic
1008215600 6:48784143-48784165 CAGAGAAGAGAAAGAAATGAAGG + Intergenic
1008265886 6:49425790-49425812 CAGAGAAAAAAGTAGAATGGTGG - Intergenic
1008286218 6:49654145-49654167 AAAAGAAAAGAGAAAAAAGAAGG - Intergenic
1008697847 6:54062304-54062326 CAGGGAAAAGTGAAAATTGAGGG - Intronic
1008954984 6:57205693-57205715 AAAAGAAAAGAAAAAAATGGGGG + Intronic
1009349143 6:62652776-62652798 AGGAGAAAAGAGGAAAAGGGGGG - Intergenic
1009612573 6:65965060-65965082 AAGAAAAAAGAGATAAATTGAGG + Intergenic
1009691865 6:67045085-67045107 CAAAGAAAAAAAAAACATGGAGG - Intergenic
1009878569 6:69537046-69537068 CAAAGAAAGGAGGAAAGTGGGGG - Intergenic
1010043662 6:71417069-71417091 GAGAGAACAGACAAGAATGGTGG - Intergenic
1010458860 6:76090144-76090166 CAGACAAAAGAAAAAAATAAAGG - Intergenic
1010783850 6:79976812-79976834 CAAAGAAAAGATAAAAGTTGTGG - Intergenic
1010897999 6:81389913-81389935 CAGAGTTAAGAGAAAAATTCAGG + Intergenic
1011122583 6:83969802-83969824 AAGAGAACAGAGAAAAAAGGAGG + Intergenic
1011172602 6:84522500-84522522 CAGAGTAAAGACAAGAAGGGAGG + Intergenic
1011234220 6:85198033-85198055 CAAAGCAAAGAGTAAAACGGTGG + Intergenic
1011773670 6:90703941-90703963 CAGAAATGAGAGAAGAATGGGGG + Intergenic
1012125484 6:95423208-95423230 TAGAGGAAAGAGAAAAGTTGGGG - Intergenic
1012167421 6:95975240-95975262 GAAAGAAAAGATTAAAATGGTGG + Intergenic
1012195729 6:96339515-96339537 TAGAGAGAAGAGAAAAAAAGAGG - Intergenic
1012286167 6:97391240-97391262 AAAAGAAAAGAAAAAGATGGTGG + Intergenic
1012291252 6:97458353-97458375 AGGAGAAATGAGAGAAATGGAGG - Intergenic
1012524802 6:100164546-100164568 TTAAGCAAAGAGAAAAATGGAGG - Intergenic
1012676376 6:102118233-102118255 GAGAGAAAAGAGAAAAAGAAAGG + Intergenic
1012798895 6:103800358-103800380 CAGAGTAAAAACAAAAAGGGAGG + Intergenic
1012809638 6:103940795-103940817 TAAAGGAAAGAGAAAAATGGGGG + Intergenic
1012931957 6:105326785-105326807 CAGAGAAAAGAGAAAAATGGAGG + Intronic
1012956122 6:105572039-105572061 CTCAAAAAAGAGAAAAATGGGGG + Intergenic
1013066331 6:106687593-106687615 TAGAGAAAACAGAAATATTGGGG - Intergenic
1013169190 6:107620769-107620791 CACAGAAAAAAGAAATATGGTGG - Intronic
1013209379 6:107973145-107973167 GAGAGAAAAGAGAAAAAGGGGGG + Intergenic
1013236919 6:108205200-108205222 CAGAGAAAAAAGTAAAATAAGGG - Intergenic
1013348236 6:109282957-109282979 AAGAGAAAAGAGAAGAGGGGAGG - Intergenic
1013455993 6:110330161-110330183 CGGAGAAAGGAAAAAAAAGGAGG - Intronic
1013604551 6:111735636-111735658 GGGAGAAAAGAGAAGCATGGGGG + Intronic
1013758461 6:113488103-113488125 CAGAGGAGAGAGAGAAAAGGGGG - Intergenic
1013778543 6:113705130-113705152 GAGAGAATTAAGAAAAATGGAGG + Intergenic
1013842413 6:114413360-114413382 CAAAGAATAGAGAAAAAAGCAGG + Intergenic
1013875414 6:114820648-114820670 CTGAGATAGGAGAAAATTGGGGG + Intergenic
1014002344 6:116378590-116378612 AATAAAAAAGAGAAATATGGAGG - Intronic
1014005710 6:116415524-116415546 GAAAGAAAAAAGAAAAAAGGGGG - Intronic
1014312231 6:119818428-119818450 CAGATAAAAGAAAAGAAGGGTGG + Intergenic
1014321697 6:119937613-119937635 CAGAGAAAAGGGAATGCTGGTGG - Intergenic
1014405754 6:121048457-121048479 CAGAGAAAAGGGAGAGATGTAGG + Intergenic
1014672134 6:124318387-124318409 CAGAGAGATGAAACAAATGGTGG + Intronic
1014717434 6:124882730-124882752 GAGAGAAAAAAGAAAAAGGAAGG + Intergenic
1014785352 6:125612224-125612246 CAAACAAAAAAGGAAAATGGGGG - Intergenic
1014795425 6:125719064-125719086 CCTAGAAAGGAAAAAAATGGAGG + Intergenic
1015360164 6:132330787-132330809 TACAGAAAAGAGAAAAACTGTGG - Intronic
1015544784 6:134350657-134350679 GAGTGAAATGAGAAAAAGGGAGG + Intergenic
1015548525 6:134387425-134387447 AAGAGAAAAGAGAACAATATGGG - Intergenic
1015730724 6:136345393-136345415 CCCAAATAAGAGAAAAATGGTGG + Intronic
1015774993 6:136804893-136804915 CAAAAAAAATAGAAAAATTGAGG + Intergenic
1015941797 6:138460078-138460100 CAGAGCAAAGGGAAAAAGTGCGG - Intronic
1016513096 6:144864911-144864933 CAGAGAAGAGAGAAAGAGAGAGG - Intergenic
1016559096 6:145374386-145374408 AAGAGAGAAAAGAAAAATGTCGG - Intergenic
1016768251 6:147819356-147819378 CAGAGAAAAGAAACAACTGTTGG + Intergenic
1016954614 6:149614393-149614415 GGGAAAAAAGAGAAAAATGAAGG - Intronic
1017070619 6:150572900-150572922 CAAAAGGAAGAGAAAAATGGAGG + Intergenic
1017114809 6:150966832-150966854 AAGGGAATAGAAAAAAATGGGGG + Intronic
1017327609 6:153158004-153158026 CAGAGCAATGAAAAAAATAGGGG + Intergenic
1017405151 6:154111412-154111434 AAGAGAAAAGAAAAAAATTGAGG + Intronic
1017454251 6:154586291-154586313 GGGAGAAAAAAGAAAAATGAAGG + Intergenic
1017607117 6:156146367-156146389 CAGAGAAAAGAGGAAAAAAGAGG - Intergenic
1017715523 6:157208697-157208719 AAAAGAAAAGAAAAAAATGAGGG - Exonic
1017799313 6:157878426-157878448 CAAAAAAAAAAAAAAAATGGTGG - Intronic
1017966023 6:159266789-159266811 CAGAGAAAAAATGTAAATGGTGG + Intronic
1017990406 6:159483102-159483124 CAAAGAAGAGAGAAAATAGGGGG + Intergenic
1018162508 6:161059942-161059964 CACAGAAAATAGAAACATGTGGG - Intronic
1018164221 6:161078440-161078462 CAGAGGAAAGCGAACAAAGGAGG + Intronic
1018360160 6:163059256-163059278 ATGAGAAAAGAGAAAAAAGACGG - Intronic
1018449450 6:163893484-163893506 CAGAGAGAAGAAAAAAATAGAGG + Intergenic
1018650969 6:165990983-165991005 GAGAGAAAAGAAAGAAATAGGGG - Intergenic
1018670065 6:166169745-166169767 AAGATAAAAGGGAAAAGTGGAGG + Intergenic
1018719269 6:166560623-166560645 CAGAAAAAAGAGAAATGGGGTGG + Intronic
1019026267 6:168966125-168966147 CAGAGAAAAGAGGAGAGGGGAGG - Intergenic
1020554243 7:9650762-9650784 AAATGAAAAGAAAAAAATGGAGG - Intergenic
1020983349 7:15099773-15099795 AGGAGAAAAGACAAAGATGGAGG + Intergenic
1021230131 7:18076318-18076340 CATAGCAAAGAGTAGAATGGTGG - Intergenic
1021529529 7:21628739-21628761 CAAAGAAAAGAGAAAATTACAGG - Intronic
1021876993 7:25058750-25058772 CAAAAAAAAGAGAAAAAAAGTGG - Intergenic
1021972939 7:25983320-25983342 GAGAGAAAACAGAAAAAGTGTGG + Intergenic
1022247419 7:28573615-28573637 CAGAGAAGAGCGAAAACTTGGGG - Intronic
1022624414 7:32019935-32019957 CAGGGAAAAGAGCAAGCTGGAGG + Intronic
1022990539 7:35702910-35702932 CAGAGAATAGAGTAATAAGGAGG - Intergenic
1023172687 7:37404914-37404936 CAGAAAAAAATTAAAAATGGGGG - Intronic
1023204171 7:37730158-37730180 AAGAGAGAAGAGAAAGAAGGGGG - Intronic
1023246550 7:38211102-38211124 CAGAAAGAAGAAAAAAATGCAGG + Intronic
1023308498 7:38856601-38856623 CAGAGAAAAGAGAAAGGGTGGGG + Intronic
1023427480 7:40053746-40053768 AAAAAAAAAAAGAAAAATGGTGG - Intronic
1023620853 7:42071027-42071049 CAGAAACAAAAGAAAAATGATGG + Intronic
1023900480 7:44473861-44473883 AAAAAAAGAGAGAAAAATGGAGG + Intronic
1024263721 7:47590701-47590723 AAGAGAAAAGAAAATAATGCCGG + Intergenic
1024440342 7:49408893-49408915 CAGAGCAAAAAAAAAAAGGGGGG + Intergenic
1025074363 7:55929941-55929963 AAGTGAAAAGATAACAATGGAGG + Intronic
1025081929 7:55991089-55991111 CCGAAAAAAGAGAAAAACTGGGG - Intronic
1025284885 7:57653154-57653176 CAGAGAGAAGAGAGAATGGGAGG + Intergenic
1025286487 7:57666611-57666633 CTGTGAAAAAAGAAAAATGGTGG - Intergenic
1025319608 7:58081124-58081146 TAGAGAACAGAGAAAAAAGTAGG + Intergenic
1025483530 7:61017411-61017433 TAGAGAAAAGACAAATATGTAGG - Intergenic
1025554104 7:62282350-62282372 TAGAGAACAGAGAAAAAAGTAGG - Intergenic
1025560677 7:62370924-62370946 TAGAGAACAGAGAAAAAAGTAGG + Intergenic
1025564871 7:62421787-62421809 TAGAGAAAAGACAAATATGTAGG - Intergenic
1025930185 7:65987209-65987231 GAAAGAAAAAAGAAAAATGTTGG - Intergenic
1026298395 7:69076366-69076388 CAGAGAAAAGAAAAACACAGGGG + Intergenic
1026328187 7:69329216-69329238 CAGAGGAAAGGAAAAAAGGGAGG - Intergenic
1026403121 7:70036525-70036547 CAGAGAGAGGAGAAACAAGGTGG - Intronic
1026480083 7:70771139-70771161 CAGAAAAAAGAAAAAAAAAGGGG - Intronic
1026544063 7:71306412-71306434 CAGAGAAAGAAGAATAGTGGGGG - Intronic
1026564163 7:71476027-71476049 AAGATAAAAGAGAATAATGATGG - Intronic
1026581793 7:71624506-71624528 AAGAGAATGGAGAAAAATGATGG + Intronic
1026584279 7:71643571-71643593 CAGAGAGCAGAGAAACATTGTGG + Intronic
1026652488 7:72227555-72227577 AAAAGAAAAAAGAAAAAAGGTGG + Intronic
1026692571 7:72562134-72562156 CAGGGAACAAAGGAAAATGGGGG - Intronic
1027638370 7:80703701-80703723 CAGAGAGAGGAGGAAAAAGGAGG - Intergenic
1027644844 7:80785028-80785050 AAAAGAAAAGGAAAAAATGGAGG - Intronic
1027948644 7:84783582-84783604 CAAAGAAAAGAGAAAGGAGGTGG + Intergenic
1028317070 7:89416418-89416440 TAGAGAAAGCAGAAAAGTGGTGG - Intergenic
1028401315 7:90428633-90428655 GAAAGAAAGGAGAAAAATGGTGG - Intronic
1028483176 7:91330302-91330324 CAGATAACAGATAATAATGGTGG - Intergenic
1028552430 7:92084266-92084288 AAGAGAAAATAAAAAAACGGGGG + Intronic
1028718688 7:94004222-94004244 CAGAGGAGAGAGAGAAAAGGCGG + Exonic
1028791069 7:94853586-94853608 CAGGGAGAAGAGAAGGATGGGGG - Intergenic
1029119872 7:98260488-98260510 AAAAGAAAAAAGAAAAATGTAGG - Intronic
1029430573 7:100526580-100526602 AGGAGAGAAGAGAAAAATGGAGG - Intergenic
1029503873 7:100950370-100950392 CAGAGAAAAGAGAAGTATAGAGG - Intronic
1029555521 7:101266315-101266337 CAGAGATAAGTGAGAAAGGGGGG - Intergenic
1029584870 7:101463848-101463870 AAGAAAAAAGAGAAAAAAGAGGG - Intronic
1029611403 7:101628462-101628484 AAAAGAAAACAGAAAACTGGAGG + Intronic
1029646470 7:101859820-101859842 CAAAGAAAAGAGAAAAAGAAAGG - Intronic
1029659715 7:101951940-101951962 CATAGATAATACAAAAATGGTGG + Intronic
1029735304 7:102462356-102462378 AAAAGAAAAGAAAAAAATTGCGG - Intronic
1029745111 7:102512294-102512316 GAGAGAAAGGAGAAGAAAGGAGG + Intronic
1029763103 7:102611455-102611477 GAGAGAAAGGAGAAGAAAGGAGG + Intronic
1029884951 7:103858958-103858980 CAGAGAAAGAAGAAGACTGGAGG + Intronic
1029908021 7:104111878-104111900 CAAAGAAAAGGCAAAAATAGGGG - Intergenic
1029923170 7:104287615-104287637 AAAAGAAAAGAGAAGAAGGGAGG - Intergenic
1030306736 7:108026538-108026560 CACAGAAAAGTAAGAAATGGTGG + Intronic
1030720521 7:112865275-112865297 CAAAAAAAAGAGAGAGATGGGGG - Intronic
1030811710 7:113980835-113980857 GAGAGAAAAGAGAATAATTAAGG + Intronic
1030832097 7:114237018-114237040 CAAATACAAGAGAAAAATGTTGG - Intronic
1030949510 7:115772115-115772137 AATAGAAAAGAGAAAATTGGAGG - Intergenic
1030978515 7:116157255-116157277 AAGAGAATAGAGAAAAAAAGCGG - Intronic
1030988959 7:116276989-116277011 AACAGAAAACAGAAAAAAGGAGG - Intergenic
1031186800 7:118491978-118492000 TAGAGAATAGAGAAAACAGGAGG - Intergenic
1031203569 7:118723836-118723858 CAAAGAAAAGAGAAAAATTAGGG + Intergenic
1031211078 7:118827250-118827272 CAGACAAAAGAGCAAAATTCAGG + Intergenic
1031244785 7:119297571-119297593 GAAAGAAAAGAGAAAATTGATGG + Intergenic
1031250944 7:119379698-119379720 AAGAGAAAAGAGAAAGATTGTGG - Intergenic
1031303869 7:120099202-120099224 CAGAAAAAAGAAAAATATTGTGG - Intergenic
1031393318 7:121242658-121242680 CAAAGAAAAGGAAAAAATGGTGG + Intronic
1031612947 7:123847824-123847846 CAGAATAAAGAGAAAAAAGGGGG - Intronic
1031872918 7:127107050-127107072 CAGAAAGGAGAGAAAAATGAAGG + Intronic
1032272033 7:130418078-130418100 AAAAGAAAAGAAAACAATGGTGG - Intronic
1032620084 7:133520768-133520790 GGGAGAATAGAGAAAAAAGGAGG - Intronic
1032676711 7:134136210-134136232 CAGACAAAAGAGATAACAGGTGG - Intronic
1032918030 7:136512993-136513015 CAAAGAAAAATGAAAAATTGGGG - Intergenic
1032928880 7:136642020-136642042 AAGAGACAAGAGAAAACTAGGGG - Intergenic
1032961678 7:137042473-137042495 AAGAGGGAAGAGAGAAATGGGGG - Intergenic
1033031684 7:137833094-137833116 CAGAGAAGACAGGAAAATGTGGG - Intronic
1033372882 7:140727617-140727639 CAAAAAAAAAAGAAAAATAGTGG - Intronic
1033593537 7:142836188-142836210 CACAGAAAAGGTCAAAATGGAGG + Intergenic
1033770276 7:144543249-144543271 AAAAGAATAGAAAAAAATGGAGG + Intronic
1033865705 7:145687977-145687999 CAGTGGCAAGAGAAAAATGAAGG + Intergenic
1033882876 7:145908314-145908336 CAGAAAAAAAAAAAAAATGGTGG + Intergenic
1034310000 7:150079090-150079112 CATAAAAATGGGAAAAATGGAGG - Intergenic
1034366488 7:150553466-150553488 AATAGAAAACAGAAAAAAGGAGG + Intergenic
1034612564 7:152385123-152385145 CAGAAAATAGAGAAACATCGGGG + Intronic
1034796846 7:154021531-154021553 CATAAAAATGGGAAAAATGGAGG + Intronic
1034911309 7:155001327-155001349 GAGGGGGAAGAGAAAAATGGTGG + Intronic
1035241594 7:157534159-157534181 CAGACAACAGAGAAAAGAGGGGG - Intergenic
1035287725 7:157816867-157816889 CTGAGTAAAGAGAAAAGAGGAGG - Intronic
1035886456 8:3296380-3296402 CTGAGAGCAGAGAAGAATGGGGG + Intronic
1035894980 8:3389724-3389746 CAGTGAAAAGAGACAAACTGCGG + Intronic
1035934238 8:3819085-3819107 CAGAGTAGAGAGAAAAGTGTAGG + Intronic
1035989013 8:4467395-4467417 ACGGAAAAAGAGAAAAATGGAGG - Intronic
1036071557 8:5445866-5445888 CACAGGAGAGAGAAAAATGAGGG - Intergenic
1036427099 8:8654763-8654785 CTGAGAAAAGAGTAAAAGGAAGG - Intergenic
1037023484 8:14003345-14003367 GAGATAACAGAGAAAAATGTAGG - Intergenic
1037375944 8:18228319-18228341 CAGAGAAAAAAGAAAACTACAGG + Intergenic
1038144799 8:24885520-24885542 CATAGAAAATGGAAGAATGGGGG - Intergenic
1038203014 8:25433439-25433461 CAAAGAAAAGAGAAAAGTCCTGG + Intronic
1038306945 8:26413496-26413518 CAGAGGAAACTGAAAAATGTAGG + Intronic
1038318856 8:26510779-26510801 TTGAGAAAAAAGAAAAAAGGAGG + Intronic
1038348526 8:26755190-26755212 CAGAGAAAAAAAAAAAAAGGAGG - Intronic
1038365811 8:26933183-26933205 CAGAACAAAGAAAATAATGGTGG + Intergenic
1038370913 8:26989523-26989545 CAGAGAAAATATGAAAATAGAGG + Intergenic
1038560766 8:28577355-28577377 TAGATTAAAGAGAAAAATGAAGG - Intergenic
1038590403 8:28832200-28832222 GAGAGAAAAGAAAAGAAGGGAGG + Intronic
1038592336 8:28851385-28851407 CAGAAAAAAGTGAGAATTGGGGG + Intronic
1038868309 8:31464201-31464223 GAAAGAAAAGAGAGATATGGAGG + Intergenic
1039098419 8:33912939-33912961 CTGAGAAAAGAGAACAAATGAGG - Intergenic
1039199250 8:35070211-35070233 TATAGAAAAGAGAAAAAGAGAGG + Intergenic
1039347184 8:36719057-36719079 GAAAGAAAAGAGAAAAAGGAAGG - Intergenic
1039524550 8:38202555-38202577 CAGAAAAAAAAAAAAAAAGGGGG - Intronic
1039556859 8:38482770-38482792 CACAGAAAAGAGAACAATCCAGG + Intergenic
1039654933 8:39394022-39394044 CACAAAAAAGAGAGAGATGGGGG - Intergenic
1039837773 8:41270445-41270467 CAGAGAAAAGAAGAAAAAGAGGG + Intronic
1039908331 8:41803152-41803174 AAAAGAAAAGAGAAAAAGAGAGG + Intronic
1040026458 8:42786543-42786565 CAAAGAAAAAAAAAAAATGCTGG + Intronic
1040105841 8:43541396-43541418 CAGAGGTAAGAGAAAAATTAGGG - Intergenic
1040280313 8:46038108-46038130 GAAAGAAAAAAGAAAAATGAAGG + Intergenic
1040486332 8:47875419-47875441 AATAGGAAACAGAAAAATGGTGG - Intronic
1040673333 8:49718144-49718166 GAAAGAAAAGAGAAAAATGAAGG - Intergenic
1040866450 8:52053158-52053180 CAGAGAAAATAGAATACTAGAGG - Intergenic
1040956135 8:52981983-52982005 CTGAGCAAAGAGAAAAATGGAGG - Intergenic
1040960604 8:53028053-53028075 TAGATAAAAGAGAGAAAGGGAGG - Intergenic
1041266297 8:56068628-56068650 GAAAGAAGAGAGACAAATGGAGG + Intronic
1041661825 8:60408385-60408407 CAAAGAAATGAAAAAAATGTTGG - Intergenic
1041985413 8:63916741-63916763 GAGAGAAAAAAGAAAGATGTAGG - Intergenic
1042356710 8:67836471-67836493 GGGAGAAGAGAGAAAAAAGGAGG - Intergenic
1042526794 8:69772524-69772546 AAAAGAAAAGAAAAAAAAGGAGG + Intronic
1042680050 8:71373143-71373165 CAGAGAAGAAAGAGAAATAGAGG + Intergenic
1042923170 8:73940093-73940115 AAAAGAAAAAAGAAAAATGTGGG + Intronic
1043022237 8:75018023-75018045 TATAGAAAGTAGAAAAATGGGGG + Intronic
1043137477 8:76546596-76546618 TAGAGAAAAGAGAAAATGGAAGG - Intergenic
1043144520 8:76636291-76636313 CAAAAAAAAAAGAAAAATAGTGG + Intergenic
1043277196 8:78413550-78413572 AAGAGAACAGAGAAGAATGGGGG - Intergenic
1043446175 8:80321370-80321392 GAGAGAAAAGAATAAAATTGTGG + Intergenic
1043722282 8:83559762-83559784 GAGAGAAAAGAAAAAAAGGAAGG - Intergenic
1043812798 8:84763210-84763232 GAGAGAAATGAGAAAAGTGAAGG + Intronic
1043948691 8:86283271-86283293 GACAGGGAAGAGAAAAATGGAGG - Intronic
1044142040 8:88668601-88668623 AAGAGGAAAGGGAAAAAAGGAGG - Intergenic
1044428472 8:92081835-92081857 GAGAGACAAGAGACAAAGGGAGG - Intronic
1044431816 8:92116433-92116455 CTGAGAAAAAAGAATAAAGGTGG - Intergenic
1044843571 8:96358974-96358996 CAGAGAATAGAGAACATTGAAGG - Intergenic
1044855369 8:96469907-96469929 CAGAAAAAATAGAAAGGTGGTGG - Intergenic
1044867377 8:96585520-96585542 AAGAGAAATGAGAAGGATGGGGG + Intronic
1045112174 8:98946629-98946651 CAGAGAAAAGGGAAAGAAGATGG + Intronic
1045196394 8:99935196-99935218 AAAAGAAAAGAAAAAAAAGGAGG + Intergenic
1045372974 8:101543449-101543471 CAGGAAGAAGAGAAAAGTGGAGG - Intronic
1045471811 8:102519316-102519338 AAGAGAAAAGGAAAAAATAGAGG + Intergenic
1045668464 8:104518302-104518324 AACAGATAAGAAAAAAATGGAGG + Intronic
1045975564 8:108127541-108127563 AAAAGAAAAGAAAAAAATGTAGG + Intergenic
1046161366 8:110370146-110370168 GAGAGAAAAAAAAAAGATGGAGG - Intergenic
1046215744 8:111143695-111143717 CAGTGAACAGAGAAAGATGTGGG + Intergenic
1046248983 8:111605101-111605123 CTGAGGAAAGAGAAAAGAGGTGG - Intergenic
1046427920 8:114080012-114080034 CAGAAAAAAAAAAAAAAAGGGGG - Intergenic
1046564211 8:115877941-115877963 CAGAGAGAAGAGGGAAAGGGAGG + Intergenic
1046579347 8:116072353-116072375 AAAAGAAAAAAGAAAAAAGGGGG + Intergenic
1046723332 8:117647412-117647434 AACAGAAAAGAGAAAAAAAGTGG - Intergenic
1046893892 8:119452038-119452060 CAGAGCAAAGAACAAAATTGAGG - Intergenic
1047023370 8:120801125-120801147 CAGAGAACAGAGGAAAATATAGG + Intronic
1047054901 8:121153077-121153099 GAGAGAAGAAAGAAAACTGGAGG - Intergenic
1047140482 8:122133512-122133534 AAGAGAAGAGAGAAAAATACTGG - Intergenic
1047351159 8:124075879-124075901 CAGAAAAATGAGAAAAATGCCGG - Intronic
1047376053 8:124297623-124297645 CTGAAAAAAGAGCTAAATGGAGG - Intergenic
1047486503 8:125335576-125335598 CAAACAAAGGAGCAAAATGGGGG + Intronic
1047507807 8:125493794-125493816 CATATAAAAGAAACAAATGGAGG - Intergenic
1047701886 8:127457053-127457075 CTGGTCAAAGAGAAAAATGGGGG - Intergenic
1047895469 8:129361679-129361701 CAGAGTTAAGAGAAAAATGTTGG + Intergenic
1047902113 8:129434252-129434274 CAGACAAGAGAAAGAAATGGAGG + Intergenic
1047964750 8:130038384-130038406 CAGTTAAAAGAAAAAAATGGGGG + Intergenic
1048161647 8:132026993-132027015 AAGGGAAAAGGGAAAAATGGTGG - Intronic
1048226280 8:132589316-132589338 CAGACAAAAGAGAGATTTGGGGG + Intronic
1048606019 8:135969720-135969742 AATAGAAAATAGAAATATGGAGG + Intergenic
1048845545 8:138601319-138601341 CAGAGGAGTGAGAAAAGTGGGGG - Intronic
1049040493 8:140109184-140109206 CCGAGCACAGAGACAAATGGAGG + Intronic
1050020432 9:1278972-1278994 CAGAGAAAAGAGAAAGCTTTGGG - Intergenic
1050275682 9:3996316-3996338 CAGAGAAAACAGAAAAATATGGG + Intronic
1050434803 9:5597763-5597785 CAGAGCAAAGAGAGAAAGAGAGG + Intergenic
1050668089 9:7964226-7964248 GGGAAAAATGAGAAAAATGGGGG + Intergenic
1050722945 9:8611751-8611773 AAGAGAAAAGAAAAGAAAGGAGG + Intronic
1050833332 9:10042652-10042674 CAAAGAACTGAGAAAATTGGAGG + Intronic
1050984711 9:12067620-12067642 CACAGAAAAGAGAAAGAAGATGG + Intergenic
1051045956 9:12873863-12873885 CAAAAAAAAAAAAAAAATGGTGG - Intergenic
1051155582 9:14140920-14140942 CAGAGAAAAAACAGAAATGCTGG + Intronic
1051173485 9:14342497-14342519 AAGAGAAAAAAGAAATAGGGAGG + Intronic
1051382451 9:16471967-16471989 CAGAGGCAAGAGAAAAAATGAGG - Intronic
1051383147 9:16479282-16479304 AAAAGAAAAGAAAAAATTGGTGG + Intronic
1051409848 9:16778100-16778122 CAGAAAATAGAGAAAAGGGGAGG - Intronic
1051480534 9:17555379-17555401 CAGAGAAAAGATAACAAAGGAGG + Intergenic
1051577956 9:18638861-18638883 TAGAGCAAAAAGAAAACTGGAGG + Intronic
1051728657 9:20115015-20115037 CATAGAGGAGAGGAAAATGGGGG + Intergenic
1051773739 9:20610992-20611014 CAGAGAAATAAGTAAAATGAAGG + Intronic
1051810174 9:21039641-21039663 CATAGAAGACAGAAAAGTGGGGG + Intergenic
1051874249 9:21774727-21774749 AAGAGAAATGAGTAATATGGAGG + Intergenic
1051961102 9:22763729-22763751 CAGAAACAGGAGTAAAATGGTGG + Intergenic
1051979850 9:23000518-23000540 CAGAGAAAAGGGTAATATGCAGG + Intergenic
1052036826 9:23692144-23692166 CAGAAAAAGGAAAAAAAGGGGGG + Exonic
1052077649 9:24163099-24163121 CAGAAAAGAAAGAAAAATGATGG - Intergenic
1052216985 9:25978691-25978713 AAGAGAAAAGAGAAAGAATGGGG - Intergenic
1052255560 9:26452361-26452383 CAGAGCAAAAAGAAAAAAGCTGG - Intergenic
1052301640 9:26958837-26958859 GAGAGAAAAGAAAAAGATGGTGG + Intronic
1052367024 9:27623927-27623949 CAAAATAAAGGGAAAAATGGTGG - Intergenic
1052394620 9:27923927-27923949 TAGAGAACAGAGAACAAGGGTGG + Intergenic
1052549439 9:29929272-29929294 CAGAGTAAAGACAAAAGTGAAGG + Intergenic
1052678880 9:31662686-31662708 CAGACAAAAAAAAAAAATGCTGG - Intergenic
1053146212 9:35713844-35713866 AAGAGAAAAAAGAAAAAGGAAGG + Intronic
1053330345 9:37200240-37200262 CAGTGAAGAGTGAAAAAAGGAGG - Intronic
1053360971 9:37486390-37486412 CAGTGAAGAGAGGGAAATGGGGG - Intronic
1053381838 9:37655290-37655312 CAGAGAGAATGGAAAGATGGGGG - Intronic
1053440077 9:38108838-38108860 CTGAGGAAGGGGAAAAATGGTGG + Intergenic
1053667570 9:40326879-40326901 CAGAGGAAAGAGTAAAATTAAGG - Intronic
1053917153 9:42951982-42952004 CAGAGGAAAGAGTAAAATTAAGG - Intergenic
1054378713 9:64466906-64466928 CAGAGGAAAGAGTAAAATTAAGG - Intergenic
1054517041 9:66049406-66049428 CAGAGGAAAGAGTAAAATTAAGG + Intergenic
1055132399 9:72791215-72791237 CAGAGACAAGAGAATAATGCAGG - Intronic
1055148460 9:72964827-72964849 AAAAGCAAAGAGAAAAATGTTGG - Intronic
1055169149 9:73233588-73233610 TACAGAATATAGAAAAATGGAGG + Intergenic
1055361605 9:75496904-75496926 GAGAGAAAAGAAAAAATTGCTGG - Intergenic
1055414455 9:76065259-76065281 CAGTGAAAAGAGAACACTGCTGG - Intronic
1055516282 9:77036852-77036874 CAGAGAGTAGAGGACAATGGAGG - Intergenic
1055524023 9:77111719-77111741 CAGGGGAAAGAGGAAAATGGAGG - Intergenic
1055605404 9:77965112-77965134 CAGAGTAAAGTAAAAAAGGGTGG - Intronic
1055610141 9:78014156-78014178 AAGAGAAAAGGAAATAATGGAGG + Intronic
1056034150 9:82585713-82585735 CAGGGAAAAGAGAAAATAGAGGG + Intergenic
1056086954 9:83160222-83160244 CTCAGAAGACAGAAAAATGGGGG + Intergenic
1056236080 9:84596104-84596126 AAATGAACAGAGAAAAATGGTGG - Intergenic
1057122278 9:92587105-92587127 CAGAGAAAAAAGAAAAAAACAGG + Intronic
1057183928 9:93045656-93045678 AAGAGAAAAGAGATAAATTGAGG + Intergenic
1057466980 9:95323270-95323292 CAGAGCAAAAAAAAAAAAGGAGG + Intergenic
1057733934 9:97635409-97635431 CAGAAAAAAAAAAAAAAGGGAGG - Intronic
1058067606 9:100566689-100566711 AAAAGAAAAAAGAAAAAAGGCGG - Intronic
1059017501 9:110535458-110535480 CTAAGAAAAAAGAAAAAAGGTGG - Intronic
1059151505 9:111953545-111953567 GAAGGAAAAGAGGAAAATGGGGG + Intergenic
1059348408 9:113647819-113647841 CAGAGAAAGGAGAAAAATTGGGG + Intergenic
1059535067 9:115073053-115073075 AAGAGAAAAGAGAAAATGAGAGG + Intronic
1059646620 9:116274474-116274496 CAGAGAAGAGAGACAAGTGTGGG + Intronic
1059695838 9:116729280-116729302 TAGAGCAGAGAGAAAAATGAGGG - Intronic
1059773960 9:117456036-117456058 CAGGGAAGAGTGAAGAATGGTGG - Intergenic
1059778164 9:117497796-117497818 AGGAAAAAAGAGAAAAATGAAGG + Intergenic
1059871197 9:118579626-118579648 AAGAGAAAAGAGAAAAATTAGGG + Intergenic
1059976442 9:119722885-119722907 CTGAGAGAAGAGAAAGAGGGAGG - Intergenic
1059986150 9:119822663-119822685 CAGTGGCAAGAGAAAAATGAGGG - Intergenic
1060298069 9:122356426-122356448 CAGAGAAGAGATAGAGATGGAGG + Intergenic
1060580289 9:124739187-124739209 CAAAAAAAAAAAAAAAATGGGGG + Intronic
1060613584 9:124990711-124990733 AAAAGAAAAAAGAAAAATGGTGG + Intronic
1060626342 9:125115796-125115818 CATAGAAAAGAGGAATATGAGGG + Intronic
1061140159 9:128761289-128761311 CTGAAAAAAGAAAAAAAAGGTGG - Intronic
1061160154 9:128889163-128889185 CTGAGAAAAGAGGGTAATGGAGG - Intronic
1061532067 9:131222202-131222224 CAGTGAAATGAGAAAAATCATGG - Intronic
1061586083 9:131569579-131569601 CAAAAAAAAAAGAAACATGGAGG - Intergenic
1061638660 9:131933265-131933287 CAGACAAGAGAAAAAAATAGAGG + Intronic
1061879016 9:133559346-133559368 CAAAAAAAAAAAAAAAATGGGGG - Intronic
1062283248 9:135761362-135761384 CAGAGAAAGGAGCAGAATGCAGG - Intronic
1062434525 9:136540974-136540996 CAAAACAAAGAGAAAAAAGGTGG + Intronic
1062609749 9:137368671-137368693 CAGAGAAAGGACCAAAATAGCGG + Intronic
1203614917 Un_KI270749v1:52054-52076 TAGAGAAAAGACAAATATGTAGG - Intergenic
1185490917 X:516394-516416 CAGAGAGAAGAGAGAAAGAGAGG - Intergenic
1185545405 X:939796-939818 GAGAGAGAAGAGAAAAGAGGAGG - Intergenic
1185575348 X:1168102-1168124 AAGAAAAAAGAGAGAGATGGAGG - Intergenic
1185759427 X:2678571-2678593 AGGAAAAAGGAGAAAAATGGAGG - Intergenic
1185991862 X:4900516-4900538 CAGAAAAAAGAGAGAAATTTGGG - Intergenic
1186290571 X:8093267-8093289 GATACAAAAGAGAAAAAGGGAGG + Intergenic
1186359771 X:8828283-8828305 CAAAGAAAAAAGAAATATGAAGG + Intergenic
1186789728 X:12985238-12985260 CAGAGAAAAGAAAGGAATTGAGG - Intergenic
1186822235 X:13301987-13302009 CAGAGAAGGCAGGAAAATGGGGG - Intergenic
1186854007 X:13608515-13608537 CAAAGAAAGGAGAGAAATAGAGG - Intronic
1186885435 X:13908565-13908587 CACAGCAAAGAGAAAAACTGGGG + Intronic
1186903846 X:14089478-14089500 AATTTAAAAGAGAAAAATGGTGG - Intergenic
1186988422 X:15041081-15041103 GAGAAAAAAGAGAAAAAGGATGG - Intergenic
1186989356 X:15050546-15050568 CATAGTAAAGGGCAAAATGGTGG + Intergenic
1187032277 X:15500233-15500255 CAGAGAAAATAGTGGAATGGGGG + Intronic
1187072872 X:15905660-15905682 CAGATAAAGGAGAAAAAGGCTGG - Intergenic
1187346866 X:18473571-18473593 CAGAGAAGGGGGAAAAGTGGAGG - Intronic
1187357450 X:18590360-18590382 CAGAGAAAGGAAAGAAATGGTGG - Intronic
1187357568 X:18591495-18591517 AAGTGAAAAGAGAAAGATCGGGG - Intronic
1187580160 X:20598986-20599008 CAAAGAAAAGAGAAAATGGATGG - Intergenic
1187658084 X:21503887-21503909 CAGGTAAAAGAGAAGAAAGGCGG - Intronic
1187796019 X:23005412-23005434 CAAAGAAAAAAAAAAAATAGAGG + Intergenic
1187807600 X:23137961-23137983 GAGAGAAAAGAAAGAAAAGGAGG + Intergenic
1188173973 X:26965028-26965050 CTTAGAAGAGAGTAAAATGGTGG + Intergenic
1188220047 X:27530360-27530382 TATAGAAAACAGAAGAATGGCGG - Intergenic
1188364631 X:29299982-29300004 CAGAAATAAGAGAAAAAAGGTGG - Intronic
1188460791 X:30424973-30424995 TAGGGTAAAGAGAAAAATTGAGG - Intergenic
1188549185 X:31343728-31343750 CAAAGAAAAGAAAAATAAGGAGG - Intronic
1188636443 X:32437465-32437487 GAGAAAAAAGAGAATAAGGGGGG - Intronic
1188702783 X:33285572-33285594 CAGAGAAGGGAGAAAAATTATGG - Intronic
1188843102 X:35039608-35039630 AACAGAAAACAGAAAAAAGGAGG + Intergenic
1188894414 X:35649356-35649378 AGGAGGAAATAGAAAAATGGAGG + Intergenic
1189082410 X:37988948-37988970 CAGAGGAAAGACATAAATTGAGG + Intronic
1189390007 X:40568667-40568689 AAGAAAAAAGAAAAACATGGAGG - Intergenic
1189395192 X:40615368-40615390 CAGAAAATTTAGAAAAATGGAGG - Intergenic
1189546982 X:42051538-42051560 AAGAGAAAAGAAAAAGTTGGGGG - Intergenic
1189770229 X:44417772-44417794 TACAAAAAATAGAAAAATGGGGG - Intergenic
1189908939 X:45790241-45790263 CAGAGAAAAGGAAAAAACAGGGG - Intergenic
1190023615 X:46902396-46902418 GAGAGAAAGGAGAAAAAGGAAGG + Intergenic
1190046883 X:47119110-47119132 AAGAAAAAAGAAAAAAAAGGAGG - Intergenic
1190383352 X:49861021-49861043 TAGAGATAAGAGAAAATTGTAGG - Intergenic
1190534620 X:51413537-51413559 AAGAGAAGAGGGAAAGATGGAGG - Intergenic
1190553606 X:51611573-51611595 GAGAGGAAAGAGAAAGAAGGAGG - Intergenic
1190876143 X:54461629-54461651 AAAAGAAAAAAGAAAAATAGGGG + Intronic
1191069327 X:56383190-56383212 AAGAGAAAGGAGAAATAAGGTGG + Intergenic
1191159000 X:57307172-57307194 CAGAGAGAATAGAAAGATGAAGG - Intronic
1191644344 X:63464130-63464152 AAGAGAAAACAGAAAAATGCAGG - Intergenic
1191858906 X:65650039-65650061 AAAAAAAAAGAGAAAAAAGGAGG - Intronic
1191922208 X:66269110-66269132 CTGAGGAAAAAGAAAACTGGGGG + Intergenic
1192106258 X:68320544-68320566 GTGAGAATATAGAAAAATGGGGG - Intronic
1192131448 X:68555372-68555394 AGGACAAAAAAGAAAAATGGAGG + Intergenic
1192194073 X:69016972-69016994 CAGAGGAAAGAGTAAGGTGGAGG - Intergenic
1192264057 X:69526641-69526663 CAAGGAAAAGAGAATAATGAGGG + Intronic
1192540247 X:71963060-71963082 TAGAGAATAGAAAAAAATGGAGG - Intergenic
1192671402 X:73146271-73146293 CAGACAAAAGAAAAAATTGAAGG - Intergenic
1192786383 X:74340176-74340198 GAGGAAAAAGAGAAAAATGAAGG + Intergenic
1193271370 X:79533436-79533458 CAGAGCAAAGAGAAAACTTATGG - Intergenic
1193306026 X:79953112-79953134 CAGACAAGAGAAAAAAATTGAGG + Intergenic
1193388542 X:80899502-80899524 GAAAGAAAACAGAAAAATGGAGG - Intergenic
1193396154 X:80986147-80986169 TGGAGAAAAGAGAAAAAAGCAGG - Intergenic
1193441581 X:81546014-81546036 TAGAGAAAAGTGATGAATGGAGG - Intergenic
1194031815 X:88826181-88826203 CAGAGAAAAGTGAAAAGTGGGGG - Intergenic
1194185230 X:90766808-90766830 CTCAGAAGAGAGAAAAATGTGGG - Intergenic
1194451647 X:94050972-94050994 AAGACAGAAGAGAAAAATGTAGG + Intergenic
1194464780 X:94219982-94220004 CAGAGAAAAGAGACAACTATAGG - Intergenic
1194926326 X:99829398-99829420 CAGACAAGAGAAAAAAATGAAGG - Intergenic
1195065981 X:101238733-101238755 CACAGGATAGAGAAAAATGTGGG - Intronic
1195250720 X:103043549-103043571 CAGAGAAGACAGAAAAAGAGTGG - Intergenic
1195286271 X:103387524-103387546 AAGAAAAAAAAGAAAAATGCTGG - Intergenic
1195318434 X:103700987-103701009 CAAAGAAAAAAGAAACTTGGTGG + Intergenic
1195660683 X:107374939-107374961 CTCAGAGAAGAGAAGAATGGTGG - Intergenic
1195816602 X:108895430-108895452 AAGAGAAGAGAGAAACAAGGAGG + Intergenic
1195861482 X:109388078-109388100 CAGAGCAGAGAGAAAAAGGTGGG + Intronic
1195907026 X:109854188-109854210 GAGAGACAACAGAAAAATAGAGG + Intergenic
1195963540 X:110409618-110409640 CAGCAACAACAGAAAAATGGGGG - Intronic
1196219232 X:113092052-113092074 CAGACAAGAGAAAAAAATGAAGG + Intergenic
1196226405 X:113172566-113172588 CAGATAAAACAAAAAGATGGAGG + Intergenic
1196265798 X:113645008-113645030 CAGAGAAAAGAATAAGATAGTGG - Intergenic
1196492632 X:116286428-116286450 CAGAGAAGAGAAGAAACTGGGGG - Intergenic
1196972760 X:121127235-121127257 TACAGTAAAGAAAAAAATGGTGG - Intergenic
1197025317 X:121740696-121740718 CATAGAAAAGAGAAATTTGCAGG - Intergenic
1197069878 X:122283954-122283976 CAGACAAGAGAAAGAAATGGAGG + Intergenic
1197072783 X:122320867-122320889 CATAGAAATGAGTAGAATGGTGG + Intergenic
1197224317 X:123941277-123941299 CAGAGAAAAAGGAATAAAGGTGG + Intergenic
1197561328 X:128025419-128025441 CAAAGAAGACAGAAAAATGTGGG - Intergenic
1197868690 X:131045494-131045516 CACAGAAAAGAGACACATGGAGG - Intergenic
1198075498 X:133189780-133189802 AAGAAAAAAAAGAAAAAAGGAGG - Intergenic
1198209594 X:134504876-134504898 GAAAGAAAAAAGAAAAAGGGGGG - Intronic
1198311708 X:135431126-135431148 AGGAGAAAAGGGAAAAATGAAGG - Intergenic
1198604918 X:138326442-138326464 TAGAAAAGAGAGAAAAATGCTGG - Intergenic
1198670221 X:139072033-139072055 GAGAGAAAAGAGAAAAATAAAGG - Intronic
1199055331 X:143287301-143287323 CAGTGAAAAGTGAAAATTTGGGG + Intergenic
1199056317 X:143299192-143299214 CAAAGAAAAGATAAAATTGGGGG + Intergenic
1199288360 X:146078536-146078558 TAGAGAAAGGAGAAAGAAGGTGG + Intergenic
1200082588 X:153585873-153585895 AAGAGAAAAGAGAAAAGAAGTGG + Intergenic
1200226055 X:154418458-154418480 CAGACAAAAGAGGAAAGAGGTGG - Intronic
1200342483 X:155412386-155412408 AAGATAGAAGAGAAAAATTGAGG + Intergenic
1200531853 Y:4348895-4348917 CTCAGAATAGAGAAAAATGTGGG - Intergenic
1200977104 Y:9224725-9224747 CAGATAAAAGAACAAAATGTTGG + Intergenic
1200984271 Y:9289455-9289477 AAGAGAAAAGAGAAAAAACATGG + Intergenic
1201465508 Y:14275993-14276015 GAGAGAGAGGAGAAAAAAGGGGG - Intergenic
1201646191 Y:16235105-16235127 CACAGAACAGAGAAGAATGTGGG + Intergenic
1201656622 Y:16350212-16350234 CACAGAACAGAGAAGAATGTGGG - Intergenic
1201957937 Y:19646687-19646709 CAGATAAAAGATAAAAATGACGG - Intergenic
1202099397 Y:21290116-21290138 CAGGAGAAAGAGAAAAATGCAGG + Intergenic
1202133991 Y:21641254-21641276 CAGATAAAAGAACAAAATGTTGG - Intergenic