ID: 1012932281

View in Genome Browser
Species Human (GRCh38)
Location 6:105329726-105329748
Sequence TTGTCTCTCTAGCACTTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 419
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 401}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012932281_1012932282 -9 Left 1012932281 6:105329726-105329748 CCTGCAAAGTGCTAGAGAGACAA 0: 1
1: 0
2: 1
3: 16
4: 401
Right 1012932282 6:105329740-105329762 GAGAGACAAGTAGTAAGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012932281 Original CRISPR TTGTCTCTCTAGCACTTTGC AGG (reversed) Intronic
900803780 1:4754344-4754366 TTGACTCTCTGGCCCTTTGCAGG + Intronic
902370967 1:16006576-16006598 GTATCTCCCCAGCACTTTGCAGG - Exonic
903876627 1:26478994-26479016 CTGTCTCTCTAGACCTTTTCTGG + Intergenic
904469935 1:30729965-30729987 TTGTCTCTCTAGACCTTTCTGGG - Intergenic
905843650 1:41207418-41207440 TTGTCTCTTTTGATCTTTGCTGG - Intronic
906452722 1:45965488-45965510 TTGTCTCTCTTGATCTTTGTTGG + Intronic
906659108 1:47569988-47570010 TTGTGTGTCAAGCACTGTGCTGG + Intergenic
906886539 1:49654687-49654709 TTGTCTCTCTTGATCTTTGTTGG + Intronic
909111695 1:71486715-71486737 TTTTATCTCTAGCTCTTTCCTGG - Intronic
909536115 1:76738401-76738423 TTGTCTCTTTTGATCTTTGCTGG + Intergenic
910915329 1:92281851-92281873 TTGTCTCTTTTGATCTTTGCTGG - Intronic
911083696 1:93958331-93958353 TTCTCTCTCTCCCTCTTTGCTGG + Intergenic
912684607 1:111752447-111752469 TTGTATCTCTAGCACTTGGCTGG + Intronic
913127532 1:115806923-115806945 TTGTATCTCCATCACATTGCAGG + Intergenic
913504914 1:119508017-119508039 TTGTCTCTCTAGAACGTGCCAGG + Intronic
913721594 1:121601952-121601974 TTGTCTCTTTTGATCTTTGCTGG + Intergenic
914388328 1:147194271-147194293 TTGTCTCTTTAGATCTTTGCTGG + Intronic
914985248 1:152450859-152450881 TTTTCTCTCTCTCACTTTGGGGG + Intergenic
915438957 1:155931990-155932012 GTGTCTCTTGAGCACTTGGCAGG + Intronic
915658915 1:157384684-157384706 TTGTCTTTCTATCTCTTAGCAGG + Intergenic
917247524 1:173020840-173020862 GTGTGTCTCCAGCACTCTGCTGG + Intergenic
917434684 1:175008378-175008400 TTGTCTTGATAGCACTTTCCAGG + Intronic
918310020 1:183279162-183279184 TTGCTTCTCAAGCCCTTTGCTGG - Intronic
918841157 1:189541285-189541307 TTTTCTCTCAATCACTTTTCTGG - Intergenic
919375409 1:196787268-196787290 TTGTGTGTCAAGCACTTTGTAGG + Intronic
920590096 1:207209115-207209137 TTGTCTCTTTTGATCTTTGCTGG - Intergenic
921006114 1:211095119-211095141 TTGCCTCTCTAGCATCTTGATGG - Intronic
922153367 1:223023114-223023136 ATGTCTCCCCACCACTTTGCAGG + Intergenic
922219469 1:223547223-223547245 TTTTTTTTCTAGCACTTTGTAGG + Intronic
923194248 1:231649821-231649843 TTGTCTCTTTTGATCTTTGCTGG + Intronic
1063226257 10:4017744-4017766 TTGACTCTCTGGCAATTTGATGG + Intergenic
1063302436 10:4862841-4862863 TTGTCTCTTTAGATCTTTGTTGG - Intergenic
1064702272 10:18034411-18034433 TTGTCTCTTTTGATCTTTGCTGG + Intronic
1065406407 10:25370932-25370954 TTGTCTCTTTTGATCTTTGCTGG + Intronic
1066787836 10:39025394-39025416 TTGTCTCTTTCGATCTTTGCTGG - Intergenic
1068552397 10:58421500-58421522 TTGTCTCTTTTGATCTTTGCTGG + Intergenic
1068609323 10:59041614-59041636 TTGTCTCTTTTGATCTTTGCTGG + Intergenic
1068970373 10:62951985-62952007 TTGTCTCTTTTGGTCTTTGCTGG - Intergenic
1070852077 10:79572708-79572730 TTGTCTCTTTTGATCTTTGCTGG - Intergenic
1071077345 10:81770979-81771001 TTGTCTCTTTTGATCTTTGCTGG + Intergenic
1071127018 10:82347831-82347853 TTGTCTCTTTTGATCTTTGCTGG + Intronic
1071349876 10:84729513-84729535 TTGTCTCTCTTGATCTTTGTTGG - Intergenic
1071663373 10:87528973-87528995 TTGTCTCTTTTGATCTTTGCTGG + Intronic
1072010522 10:91299176-91299198 TCGGCTCTCTAGCGGTTTGCCGG - Intergenic
1072101036 10:92229289-92229311 CTGTATTTGTAGCACTTTGCGGG - Intronic
1072383174 10:94896676-94896698 TTGTCTCTTTTGATCTTTGCTGG + Intergenic
1073016239 10:100401808-100401830 TTGTTTTCCTAGCACTTAGCAGG - Intergenic
1073097292 10:100987588-100987610 TTTTCTCTCTCCCACTTCGCCGG - Intronic
1073708367 10:106012502-106012524 TTGTTTATCTTGCAGTTTGCTGG + Intergenic
1074053980 10:109905507-109905529 TTCTCTCTCTAAGATTTTGCTGG - Intronic
1074431137 10:113395798-113395820 GTGTCTCTCTAGGACTATGAGGG - Intergenic
1074601968 10:114923694-114923716 TTGCCTGCCTAGCACTGTGCTGG + Intergenic
1074981748 10:118625567-118625589 TTGTCCTTCTCACACTTTGCTGG - Intergenic
1075912389 10:126135895-126135917 TTGTCTCTCTGGCACCCTACAGG + Intronic
1076419299 10:130318135-130318157 TTGTCTCTTTTGCTCTTTGTTGG + Intergenic
1080438051 11:32264412-32264434 CTGTCTCTCTCTCACTTTACAGG - Intergenic
1080712459 11:34762600-34762622 TTGTCTCTTTTGATCTTTGCTGG + Intergenic
1081377731 11:42379179-42379201 TTGTCTCTCTTGATCTTTGTTGG - Intergenic
1083802805 11:65056662-65056684 TTGTAATCCTAGCACTTTGCGGG - Intronic
1084796995 11:71513402-71513424 TTGTCTCTTTTGAACTTTGTTGG - Intronic
1086139178 11:83475309-83475331 ATGTCTTTGTGGCACTTTGCGGG + Intronic
1086267353 11:85017108-85017130 TTTACTCTCTAGCCCTTTACTGG + Intronic
1087003218 11:93442804-93442826 TTGTCTCTTTTGAACTTTGTTGG + Intergenic
1087174605 11:95084890-95084912 TTGTCTCTCTAGCACATATAAGG - Intergenic
1087762824 11:102120536-102120558 TTGTCTCTCTATCTCTTTATGGG + Intronic
1090625838 11:128607871-128607893 TTGTCTCTCTGGCACGTGTCAGG + Intergenic
1091421543 12:345146-345168 TTGTCTCTTTAGATCTTTGTTGG - Intronic
1091723367 12:2828947-2828969 TTGTAGTTCTAGCACTTTGGAGG + Intronic
1092456774 12:8650907-8650929 TTGTAATTCCAGCACTTTGCGGG + Intronic
1093712498 12:22343096-22343118 TTGTCTCTTTTGATCTTTGCTGG - Intronic
1093975535 12:25416739-25416761 TTGGCTCTCTCACACGTTGCTGG - Intronic
1094656778 12:32427826-32427848 TTGTCTCTCTTGATCTTTGTTGG + Intronic
1095320143 12:40817411-40817433 TTGTCTTTTTAGCTCTTTGTTGG + Intronic
1096131494 12:49162588-49162610 TTCTTTCTGTAGCACTTGGCTGG - Intergenic
1096164231 12:49407670-49407692 TTTTCTCTGTAGCACTTATCTGG + Intronic
1096891842 12:54779108-54779130 TTGTCTCTTTTGATCTTTGCTGG - Intergenic
1099194819 12:79603339-79603361 TTTTCTTTTTACCACTTTGCTGG - Intronic
1100207760 12:92369641-92369663 TTGCCTCTCCAACACTTCGCTGG + Intergenic
1100606441 12:96155623-96155645 TTTTCTCCATAGCACTTTTCAGG + Intergenic
1100896503 12:99188072-99188094 TTGTCTCTCTTGATCTTTGTTGG - Intronic
1102424965 12:112836802-112836824 TTGTTTCTGCAGCATTTTGCTGG + Intronic
1106326092 13:28691838-28691860 TTGTCTCTTTTGCTCTTTGTTGG + Intergenic
1106333292 13:28760053-28760075 TGGTCTATCTTGCACTTTGAAGG - Intergenic
1106445544 13:29827443-29827465 TTGTCTCTTTTGATCTTTGCTGG + Intronic
1107507132 13:41046048-41046070 TTGTCTCTTTTGATCTTTGCTGG + Intronic
1107835241 13:44407599-44407621 TTCTCTCTCAAGAACCTTGCAGG + Intergenic
1108355270 13:49624351-49624373 ATGTTTCTCTAGCACTTTCCAGG + Intergenic
1108547771 13:51513466-51513488 TTGTCTCTTTTGAACTTTGTTGG + Intergenic
1109816444 13:67590750-67590772 TTGTCTCTTTTGGTCTTTGCTGG - Intergenic
1110811924 13:79820820-79820842 TTGTCTCTTTTGATCTTTGCTGG + Intergenic
1110814078 13:79842032-79842054 TTGTCTCTTTTGATCTTTGCTGG - Intergenic
1111779215 13:92700190-92700212 TTGTCTCTTTTGAACTTTGTTGG + Intronic
1113131419 13:107041819-107041841 TTGTCTCTTTTGAACTTTGTTGG + Intergenic
1113187469 13:107705384-107705406 CTGTCTCACAAGTACTTTGCTGG - Intronic
1115043231 14:28956578-28956600 TTGTCTTTCTTGACCTTTGCTGG - Intergenic
1117008441 14:51446121-51446143 TTGTATGCCTAGCACTGTGCTGG + Intergenic
1117301454 14:54432935-54432957 TTGTGTCTGTAGCATTTTGTTGG - Intronic
1117502851 14:56371759-56371781 TTGTCTTTTTTGCTCTTTGCTGG + Intergenic
1117852909 14:59993690-59993712 TTGTCTCTTTTGATCTTTGCTGG - Intronic
1117936381 14:60912085-60912107 TTGTCTCTCTTGATCTTTGTTGG + Intronic
1117938948 14:60939996-60940018 TTGTCTCTCTTGATCTTTGTTGG + Intronic
1118446728 14:65858624-65858646 TTGTCTCTTTTGAACTTTGTTGG + Intergenic
1118521094 14:66586153-66586175 TTGTCTCTTTTGCTCTTTGTTGG + Intronic
1120366821 14:83581860-83581882 TGCTCTCTTTAGTACTTTGCTGG - Intergenic
1120850798 14:89167609-89167631 ATGTCTTTCTACCACTTGGCTGG - Intronic
1121176946 14:91897589-91897611 TTCTCTCTGTAGGACTTGGCAGG - Intronic
1121299836 14:92861601-92861623 TTGTGTCCCCAGCACCTTGCAGG + Intergenic
1121432384 14:93896877-93896899 TTGACTCTCTGGCTCTTTCCAGG + Intergenic
1122377010 14:101268438-101268460 TTGTCTCTTTTGCTCTTTGTTGG - Intergenic
1123430632 15:20212813-20212835 TTGTATTTCTGGCACTTTTCTGG - Intergenic
1124670024 15:31630851-31630873 TTGTCTCTTTTGATCTTTGCTGG + Intronic
1125128804 15:36257135-36257157 TTGTCTCTTTAGATCTTTGTTGG + Intergenic
1125205683 15:37151472-37151494 TTGTCTCCATAGCTCTCTGCAGG - Intergenic
1126470516 15:49005496-49005518 TTGTCTCTCTTGATCTTTGTTGG + Intronic
1126505366 15:49398225-49398247 TTGTCTCTCTTGATCTTTGTTGG - Intronic
1128026181 15:64438952-64438974 TTGTCTCTGTAGCATTGAGCTGG + Intronic
1128416549 15:67451988-67452010 TTGTCTCTTTAGATCTTTGTTGG + Intronic
1128696805 15:69771434-69771456 TTGTCTCTTTTGATCTTTGCTGG - Intergenic
1130828756 15:87577872-87577894 TTGTCTTTCTAGCACTTACTAGG + Intergenic
1132214251 15:100050998-100051020 TTGTCTCTCATGCACACTGCAGG - Intronic
1133533085 16:6673828-6673850 TTTTCTCTCTAGCACTGTCTTGG - Intronic
1133694386 16:8247708-8247730 CTGTTTCTCTAGAACTCTGCAGG + Intergenic
1134501754 16:14774471-14774493 TTTTCTCTCTAGATCTCTGCAGG - Intronic
1134578808 16:15354408-15354430 TTTTCTCTCTAGATCTCTGCAGG + Intergenic
1134723779 16:16403139-16403161 TTTTCTCTCTAGATCTCTGCAGG - Intergenic
1134943650 16:18308731-18308753 TTTTCTCTCTAGATCTCTGCAGG + Intergenic
1135918824 16:26629746-26629768 TTGTCTCTCTAATACCTTGAAGG - Intergenic
1138749354 16:59400019-59400041 TTTACTCTCTGGCACTTTACAGG + Intergenic
1140897817 16:79340657-79340679 ATGTCTCCCTATCACTTTCCAGG - Intergenic
1143157390 17:4846791-4846813 TTGTCATCCTAGCACTTTGGGGG - Intronic
1152390498 17:80001303-80001325 TTGTTTCTGTAGCACTTGGCAGG - Intronic
1153669751 18:7399667-7399689 TTGTCTCTTTTGATCTTTGCTGG - Intergenic
1153727210 18:7968684-7968706 TTGTCTCTCTTGATCTTTGTTGG - Intronic
1154186051 18:12184005-12184027 TTGTCTCTTTTGATCTTTGCTGG - Intergenic
1154320456 18:13346841-13346863 TTGTCTCTCTTGATCTTTGTTGG + Intronic
1155178950 18:23326429-23326451 TTGTCTCTTTTGAACTTTGTTGG - Intronic
1155664955 18:28297355-28297377 TTGTCTCTTTTGATCTTTGCTGG + Intergenic
1157631241 18:49098623-49098645 TTCTTTCTCAAGCAGTTTGCTGG + Intronic
1157714830 18:49876894-49876916 TTTTCTTTATAGCACTTAGCAGG + Intronic
1158524498 18:58200357-58200379 TTGTCCAGCTAGCACATTGCTGG - Intronic
1158642570 18:59216282-59216304 CTGTAACTCCAGCACTTTGCAGG + Intergenic
1159570019 18:70102336-70102358 TTGTCTCTTTAGATCTTTGTTGG + Intronic
1160079443 18:75711011-75711033 TAATCTCTCTAGCATTTTTCTGG + Intergenic
1160285166 18:77535910-77535932 TTGTCTCTTTTGATCTTTGCTGG + Intergenic
1161832544 19:6618092-6618114 CTGTAATTCTAGCACTTTGCAGG + Intergenic
1163976143 19:20854432-20854454 TTGTCTCTTTTGATCTTTGCTGG - Intronic
1164111037 19:22159288-22159310 TTGTCTCTTTTGATCTTTGCTGG + Intergenic
1164132929 19:22382435-22382457 TTGTCTCTATTGCTCTTTGTTGG + Intergenic
1164165887 19:22674296-22674318 TTGTCTCTATTGCTCTTTGTTGG - Intergenic
1164688446 19:30188421-30188443 TTGTCTCTTTTGATCTTTGCTGG + Intergenic
1164816110 19:31204724-31204746 TTGTCTTTCCTGCACTTTGCAGG + Intergenic
1165150253 19:33756077-33756099 TTCGCTCTCCAGCACTTTGGGGG - Intronic
1167945147 19:52982214-52982236 TTGTCTCTTCAGCTCTCTGCTGG - Intergenic
926387341 2:12349775-12349797 TTGTTTCCCCAGCACTGTGCTGG + Intergenic
927100691 2:19785576-19785598 TTGTGGCTCAAGCACTTTGACGG - Intergenic
929527016 2:42714048-42714070 CTATTTCTCTAGAACTTTGCTGG + Intronic
930177140 2:48313282-48313304 TTGTCTTTCTTGCACTGTCCTGG - Intergenic
930962100 2:57274616-57274638 TTGTCTCTTTTGATCTTTGCTGG + Intergenic
931530887 2:63212850-63212872 TTGTCTCTTTTGATCTTTGCTGG - Intronic
932003717 2:67907256-67907278 TTGCCTCTCTGGGACATTGCAGG + Intergenic
932899745 2:75683851-75683873 TTGTCTCTTTTGATCTTTGCTGG - Intronic
933594103 2:84264723-84264745 TTGTCTCTTTTGATCTTTGCTGG - Intergenic
933801783 2:85966159-85966181 TTGTCTCTTTTGATCTTTGCTGG - Intergenic
934618193 2:95788198-95788220 TTCTCCCTCAAGCAGTTTGCAGG - Intergenic
934642700 2:96036361-96036383 TTCTCCCTCAAGCAGTTTGCAGG + Intronic
935846445 2:107170633-107170655 TTGTCTTTTAAGCACTTTTCTGG + Intergenic
938442113 2:131345248-131345270 TTGTCTCTTTTGATCTTTGCTGG + Intronic
938445656 2:131375654-131375676 TTGTCTCTTTTGATCTTTGCTGG - Intergenic
938550506 2:132376850-132376872 ATGTCTCTCTTGGACTTTGGGGG + Intergenic
938865392 2:135414331-135414353 TTGTCTCTCTTGATCTTTGTTGG - Intronic
938889156 2:135685018-135685040 TTGTTACCCTAGCACTTTGGGGG - Intronic
939019716 2:136944648-136944670 TTGTCTCTTTTGAACTTTGTTGG + Intronic
939890405 2:147729245-147729267 TTGTCTCTCTTGATCTTTGTTGG - Intergenic
940172111 2:150840435-150840457 TTGTTTCTCTAGTTCTTTGAGGG + Intergenic
940357727 2:152763798-152763820 TTGACTCTCTGGCACTTTCTAGG - Intergenic
940417250 2:153437590-153437612 TTGTCTCTTTTGATCTTTGCTGG + Intergenic
942467280 2:176222016-176222038 TTGTCTCTTTTGATCTTTGCTGG + Intergenic
942542459 2:177028755-177028777 TTGCCTCTCTAGCCCAATGCAGG + Intergenic
942731412 2:179064940-179064962 TTGTCTCTTTAGATCTTTGTTGG + Intergenic
943791522 2:191937974-191937996 TTTTCTCTCTAGCACATTTTGGG + Intergenic
944477019 2:200117270-200117292 TTGTCTCTTTTGATCTTTGCTGG + Intergenic
944600927 2:201302308-201302330 TTGTCTCTTTTGATCTTTGCTGG - Intronic
944983745 2:205151526-205151548 TTGTCTCTTTTGAACTTTGTTGG + Intronic
945615167 2:212057157-212057179 TTGTCTCTTTCGATCTTTGCTGG - Intronic
1170130057 20:13009651-13009673 TTTTGTCTCAAGCATTTTGCGGG + Intronic
1171898514 20:30834098-30834120 TTGTCTCTTTTGATCTTTGCTGG + Intergenic
1172497546 20:35399238-35399260 TTGCTTCTCTGGCAGTTTGCTGG - Intronic
1174521719 20:51136512-51136534 GTCTCTCTCTGGCCCTTTGCAGG + Intergenic
1174831247 20:53814200-53814222 CTGTTTCTCTAGCTCTTTGCTGG - Intergenic
1175044503 20:56092305-56092327 TTGTCTTTCTCCCACTATGCAGG - Intergenic
1176075042 20:63244556-63244578 CTGTCTCTCCTGCACTTTGCCGG - Intronic
1180323300 22:11343781-11343803 TTGTCTCTTTTGATCTTTGCTGG - Intergenic
1181256233 22:21564569-21564591 ATGACTCCCTTGCACTTTGCAGG - Intronic
1182184749 22:28390607-28390629 TTGTCTCTTTTGATCTTTGCTGG + Intronic
1182204765 22:28612204-28612226 TTGTCTCTCTTGATCTTTGTTGG - Intronic
1182209804 22:28665525-28665547 TTGTCTCTTTTGATCTTTGCTGG - Intronic
1182540720 22:31039823-31039845 TTGTCTTTCTCCCACTTTGGGGG - Intergenic
1182790032 22:32943825-32943847 TTGTCTCTTTTGATCTTTGCCGG - Intronic
949377872 3:3409710-3409732 TTGTCTCTTTTGATCTTTGCTGG - Intergenic
949434701 3:4016181-4016203 TTGTCTCTCAAGAACACTGCTGG + Intronic
949580352 3:5382059-5382081 TTGTCTCTTTTGAACTTTGTTGG + Intergenic
950233882 3:11301101-11301123 TGGTTTCTCTAACACTTTTCTGG - Intronic
950596986 3:13993466-13993488 TTGTCTCTTTTGATCTTTGCTGG + Intronic
950654194 3:14426649-14426671 TTGTCTGTCTGGCACTGTGACGG - Intronic
950817205 3:15717818-15717840 TTTTACCTCTACCACTTTGCAGG + Intronic
951493554 3:23300048-23300070 TTGTCTCTTTTGATCTTTGCTGG + Intronic
951747580 3:25996880-25996902 TTGTCTCTTTGGATCTTTGCTGG + Intergenic
952025635 3:29077939-29077961 TTGTTTCTCTAGTACTTTGTAGG - Intergenic
952029983 3:29130311-29130333 TTGTCTCTTTTGATCTTTGCTGG + Intergenic
954015080 3:47681737-47681759 TTATCTTTCTAGAAGTTTGCCGG - Intronic
955211139 3:56942198-56942220 TTGGCTTTATTGCACTTTGCAGG + Intronic
956296073 3:67715111-67715133 TTGTCTCTTTGGCACATGGCAGG + Intergenic
956513402 3:70019346-70019368 TTGTCTCTTTTGAACTTTGTTGG + Intergenic
957475069 3:80711805-80711827 TTGTCTCTTTTGAACTTTGTTGG - Intergenic
959096342 3:101960649-101960671 TTGTCTATCTCCCATTTTGCAGG - Intergenic
959103209 3:102037661-102037683 TTGTTTCTCTAACTCTTTCCTGG - Intergenic
959522514 3:107336079-107336101 TTGTCTCTTTTGATCTTTGCTGG - Intergenic
960238754 3:115316082-115316104 TTGTCTCTTTTGATCTTTGCTGG + Intergenic
960758810 3:121049656-121049678 TCGTCTCTGCAGCACCTTGCAGG - Intronic
960956893 3:123038686-123038708 TTGTGTCTCTAGCACAGTGCTGG + Intergenic
961291726 3:125852190-125852212 TTGTCTCTTTTGATCTTTGCTGG - Intergenic
962291671 3:134142246-134142268 TTGTCTCTTTTGAACTTTGTTGG - Intronic
963032251 3:140989931-140989953 TTGTCTCTTTTGATCTTTGCTGG - Intergenic
963450682 3:145478343-145478365 TTGTCTCTTTTGATCTTTGCTGG + Intergenic
964126526 3:153239524-153239546 TTGTCTCTTTTGATCTTTGCTGG + Intergenic
967058557 3:185851280-185851302 TCCTCCCTCCAGCACTTTGCTGG - Intergenic
969101599 4:4773526-4773548 TAGTCTGTCTAGCACTTTGGAGG - Intergenic
970643459 4:18092597-18092619 TTGTCTCTTTTGATCTTTGCTGG - Intergenic
970896223 4:21107362-21107384 TTGTCTCTTTTGATCTTTGCTGG + Intronic
972417500 4:38856315-38856337 TTGTCACTGTAACAGTTTGCTGG - Intronic
972505894 4:39719409-39719431 TTTTCTCTTTAGCACCTTGTAGG + Intronic
972777502 4:42256550-42256572 TTTTCTCTCTGGGCCTTTGCTGG - Intergenic
973137525 4:46726324-46726346 TTGTCTCTTTTGAACTTTGTTGG + Intergenic
973564323 4:52168977-52168999 TTGTCTCTTTTGATCTTTGCTGG + Intergenic
973858623 4:55038561-55038583 TTGTTTCTCTAGCTTTTTGAAGG - Intergenic
974044565 4:56886957-56886979 TTGTCTCTTTTGATCTTTGCTGG - Intergenic
974184402 4:58428255-58428277 TTGTCTCTTTTGATCTTTGCTGG + Intergenic
974378587 4:61108605-61108627 TTGTCTCTTTTGCTCTTTGTTGG - Intergenic
974470419 4:62311623-62311645 TTGTCTCTTTTGATCTTTGCTGG - Intergenic
974720102 4:65727029-65727051 TTGTCTCTTTAGATCTTTGTTGG - Intergenic
974768952 4:66385641-66385663 TTGCCTCTCTAGCTCTTTTAAGG - Intergenic
974947435 4:68544822-68544844 TTGTCTCTTTTGATCTTTGCTGG - Intronic
975291929 4:72687429-72687451 TTGTCTCTTTTGATCTTTGCTGG + Intergenic
975306320 4:72853152-72853174 TTGTCTCTTTTGATCTTTGCTGG - Intergenic
975726703 4:77299250-77299272 TTGTCTCTTTTGCTCTTTGTTGG + Intronic
975729633 4:77325380-77325402 TTGTCTCTTTTGCTCTTTGTTGG + Intronic
976924734 4:90483136-90483158 TTGTCTCTCTTGATCTTTGTTGG + Intronic
977057457 4:92211476-92211498 TTGTCTCTCTTGATCTTTGTTGG - Intergenic
978216889 4:106215593-106215615 TTGTCTCTTTTGATCTTTGCTGG - Intronic
978257899 4:106714489-106714511 TTGTCTCTTTAGATCTTTGTTGG - Intergenic
978517572 4:109585211-109585233 TTGTCTCTTTTGATCTTTGCTGG + Intronic
979175756 4:117660407-117660429 TTGTCTCTTTAGATCTTTGTTGG - Intergenic
980903479 4:138927280-138927302 ATGTCTCTTTAGCAGTTTCCTGG - Intergenic
981439909 4:144770917-144770939 TTGTCTCTTTTGCTCTTTGTTGG - Intergenic
981442019 4:144793957-144793979 TTGTCTCTTTTGCTCTTTGTTGG - Intergenic
981446043 4:144839106-144839128 TTGTCTCTCTTGATCTTTGTTGG - Intergenic
981456567 4:144960370-144960392 TTGTCTCTCTTGATCTTTGTTGG + Intergenic
981493699 4:145368816-145368838 TTGTCTCTTTTGCTCTTTGTTGG + Intergenic
982825972 4:160004053-160004075 TTGTCTCTTTTGATCTTTGCTGG - Intergenic
983392177 4:167146188-167146210 TTGTCTCTTTTGATCTTTGCTGG - Intronic
983598577 4:169498170-169498192 TTGTCTCTTTTGATCTTTGCTGG + Intronic
984040009 4:174720376-174720398 TTGTATGTCTGGCACTATGCTGG + Intronic
986205009 5:5615453-5615475 CTGTATCTCTCACACTTTGCTGG + Intergenic
986552948 5:8979011-8979033 ATGTCTCTCTAGTACATGGCAGG + Intergenic
987183302 5:15388215-15388237 TTTACTCTCTGGCCCTTTGCAGG - Intergenic
988436013 5:31176576-31176598 TTGTATATCTAGGACTGTGCTGG - Intergenic
989134755 5:38142801-38142823 TTATTTCTCTGGCAATTTGCTGG - Intergenic
989226684 5:39036694-39036716 TTGTCTCTTTTGATCTTTGCTGG - Intronic
990181810 5:53169108-53169130 CTGTCTCTCTTGCAATTTACTGG - Intergenic
990226721 5:53663596-53663618 TTGTCTCTTTTGATCTTTGCTGG + Intronic
990337638 5:54790871-54790893 TTGTCTCTTTTGACCTTTGCTGG - Intergenic
992516921 5:77503253-77503275 TTGTCTCTCTTGATCTTTGTTGG - Intronic
993142586 5:84052686-84052708 TTGTCTCTTTTGCTCTTTGTTGG - Intronic
993341418 5:86729601-86729623 TTGTCTCTCTTGATCTTTGTTGG + Intergenic
994586316 5:101714009-101714031 TTGTCTCTTTAGATCTTTGTTGG + Intergenic
994900083 5:105760178-105760200 ATGTCTCTATAGCACCTTACTGG + Intergenic
995215140 5:109586846-109586868 TGGTCTGTCTTGCACTTTGATGG - Intergenic
995413420 5:111883204-111883226 TTGTCTCTTTTGATCTTTGCTGG - Intronic
995507208 5:112872839-112872861 TTACCTCTCTTGCACTTTTCTGG - Intronic
995690164 5:114817060-114817082 TTGTCTCTTTTGATCTTTGCTGG + Intergenic
996212941 5:120833793-120833815 TTGTCTCTTTTGATCTTTGCTGG - Intergenic
996639787 5:125738624-125738646 TTGTCTCTTTTGAACTTTGTTGG + Intergenic
996658883 5:125975179-125975201 ATGACTCTCTAGTCCTTTGCAGG + Intergenic
997136833 5:131335732-131335754 TTGTCTCTTTTGATCTTTGCTGG + Intronic
999352519 5:150888197-150888219 TTGTCTTTCTAAATCTTTGCTGG - Intronic
1001884656 5:175278465-175278487 CTGTCTCTATGGCACTGTGCAGG + Intergenic
1003765896 6:9236130-9236152 TTGTCGCTCTACCATTTTGGGGG + Intergenic
1004094178 6:12536396-12536418 TTATCTCACTAGGACTTTGATGG - Intergenic
1004844159 6:19620755-19620777 TTGTCTCTTTTGATCTTTGCTGG - Intergenic
1005101656 6:22178621-22178643 TTGTCTCTTTTGATCTTTGCTGG + Intergenic
1005208284 6:23430512-23430534 TTGTCTCTCTTGATCTTTGTTGG + Intergenic
1007288945 6:40769743-40769765 TGGTCTTTCCAGCACTTTGCTGG + Intergenic
1008281480 6:49600909-49600931 TTGTCTCTCTTGATCTTTGTTGG - Intergenic
1009248015 6:61263684-61263706 TTGTCTCTTTTGATCTTTGCTGG + Intergenic
1009455494 6:63851052-63851074 TTGTCTCTCTTGATCTTTGTTGG - Intronic
1009518891 6:64657118-64657140 TTGTCTCTTTTGAACTTTGTTGG + Intronic
1009532749 6:64842233-64842255 TTGTTTTTCTGTCACTTTGCTGG - Intronic
1009820067 6:68788918-68788940 TTGTCTCTTTTGAACTTTGTTGG + Intronic
1010699732 6:79029150-79029172 TTCTCTCTCTGGCAATTTGATGG - Intronic
1011076162 6:83441540-83441562 TTGTCTCTTTTGATCTTTGCTGG + Intergenic
1011815892 6:91189985-91190007 TTGTCTCTTTTGATCTTTGCTGG + Intergenic
1012932281 6:105329726-105329748 TTGTCTCTCTAGCACTTTGCAGG - Intronic
1013005168 6:106065871-106065893 TTGTCTCTCTAGGGCTTAGCTGG + Intergenic
1013227876 6:108133815-108133837 CTGTCTCTCTAGGGCTTCGCTGG - Intronic
1014178404 6:118355231-118355253 TTTCCTTTATAGCACTTTGCAGG + Intergenic
1015430121 6:133121420-133121442 TTGTCTCTTTTGAACTTTGTTGG + Intergenic
1015711220 6:136142715-136142737 TTGTCTCTTTTGATCTTTGCTGG + Intronic
1018677077 6:166231662-166231684 ATGGCTCTCTAGCCCTTTCCAGG + Intergenic
1018749541 6:166791242-166791264 TTGTCTCTTTTGATCTTTGCTGG - Intronic
1018760183 6:166887197-166887219 TTGTCTCTTTTGATCTTTGCTGG - Intronic
1018977608 6:168577248-168577270 TTATCTCTGTAAGACTTTGCTGG + Intronic
1020622575 7:10535564-10535586 TTGTCTCTTTTGATCTTTGCTGG - Intergenic
1021390254 7:20084291-20084313 TTCTCTCTAGAGCACTTTGATGG - Intergenic
1021618851 7:22530538-22530560 TTGTCTCTCTTGATCTTTGTTGG - Intronic
1021755437 7:23846932-23846954 TTGTCTCTTAAGGTCTTTGCTGG - Intergenic
1022324452 7:29318393-29318415 TTTTCTCTCCAGCCCTTTACAGG + Intronic
1023034926 7:36122332-36122354 TTGTCTCTTTTGATCTTTGCTGG - Intergenic
1023273421 7:38492043-38492065 TTCTCTCACTAGCACATTCCAGG + Intronic
1024153188 7:46593271-46593293 TTGTCTCTTTTGCTCTTTGTTGG - Intergenic
1024704645 7:51943628-51943650 TTGTCTCTTTTGATCTTTGCTGG - Intergenic
1025876296 7:65482653-65482675 TTGTCTCTTTTGATCTTTGCTGG - Intergenic
1026097231 7:67356163-67356185 TTTTTTTTCTAGCACTTTGTAGG + Intergenic
1027330532 7:77088309-77088331 TTGTCTCTTTTGATCTTTGCTGG + Intergenic
1027493434 7:78859001-78859023 TTGTCTCTTTTGATCTTTGCGGG + Intronic
1027812523 7:82922830-82922852 ATGTCTCTCTAGCAGTATGATGG - Intronic
1028085835 7:86636073-86636095 TTGTCTTTCTTACAGTTTGCAGG - Intergenic
1028412776 7:90549153-90549175 TTGTCTCTTTTGATCTTTGCTGG + Intronic
1028821665 7:95218732-95218754 TTGTCTCTTTTGATCTTTGCTGG + Intronic
1029608463 7:101614104-101614126 TTGTCTCTAAAACACTATGCAGG - Intronic
1029785229 7:102783027-102783049 TTGTCTCTTTTGATCTTTGCTGG - Intronic
1030466589 7:109910439-109910461 TTGTCTCTTTTGATCTTTGCTGG - Intergenic
1030960221 7:115910908-115910930 ATCTCTCTCAAGCACTTTGTTGG - Intergenic
1034110356 7:148531343-148531365 TTGTCTCTTTTGATCTTTGCTGG - Intergenic
1036669138 8:10768588-10768610 TTGTGTGGCCAGCACTTTGCTGG - Intronic
1039154310 8:34537783-34537805 TTGTCTCTTTTGATCTTTGCTGG - Intergenic
1039686367 8:39806329-39806351 TTGTTTGTTTAGCGCTTTGCTGG - Intronic
1040571952 8:48619367-48619389 TTTTCACTCTAGCCCTTTGCAGG + Intergenic
1041176670 8:55203855-55203877 TTGTGTCCAGAGCACTTTGCAGG + Intronic
1041634540 8:60128427-60128449 TTGTCTCTTTTGATCTTTGCTGG + Intergenic
1042531820 8:69823503-69823525 TTGTCTCTTTTGATCTTTGCTGG - Intronic
1042679971 8:71372182-71372204 TTTTCTCTCTAGAAGTTTGTAGG - Intergenic
1043535804 8:81203179-81203201 TTGTCTCTTTTGATCTTTGCTGG + Intergenic
1044783768 8:95772808-95772830 TTTTCTCTCCAGCACTTTATTGG - Intergenic
1045779211 8:105844420-105844442 TTGTCTCTCTTGCTCTTTTTTGG + Intergenic
1045788926 8:105958028-105958050 TTGTCTCTTTTGCTCTTTGTTGG - Intergenic
1045794414 8:106025677-106025699 TTGTCTCTTTTGCTCTTTGTTGG - Intergenic
1046220182 8:111203301-111203323 TTGTCTCTTTTGAACTTTGTTGG - Intergenic
1046729556 8:117710436-117710458 TTTTCTCTCTAGCACTTCCTAGG + Intergenic
1046862870 8:119114191-119114213 TTGTGTCTCTACCACTTATCAGG - Intergenic
1047046045 8:121054455-121054477 TTGTCTCTTTTGATCTTTGCTGG + Intergenic
1047639498 8:126803384-126803406 TTGTCTCTTTTGAACTTTGTTGG + Intergenic
1047913094 8:129552540-129552562 TTCTCTCTCTAGCACATGACAGG - Intergenic
1048410908 8:134171595-134171617 TTCTATCTCTAGCATTTTGAGGG - Intergenic
1049119045 8:140717699-140717721 TTGTCTCTCTAGCACAATCCTGG - Exonic
1049485063 8:142852310-142852332 TTGTCTCTTTTGATCTTTGCTGG - Intronic
1049934080 9:483984-484006 TTGTTTGGCTAGCACTTTGTTGG - Intronic
1050294340 9:4189758-4189780 TTGTCTCTTTTGATCTTTGCTGG + Intronic
1051987475 9:23107456-23107478 TTGTCTCTTTTGATCTTTGCTGG - Intergenic
1052061308 9:23964458-23964480 TTGTCTCTTTTGATCTTTGCTGG + Intergenic
1052132077 9:24860164-24860186 TTGTCTCTTTTGCTCTTTGTTGG - Intergenic
1052667767 9:31517139-31517161 TTGTCTCTTTTGATCTTTGCTGG + Intergenic
1053699874 9:40679443-40679465 TTGTCTCTTTAGATCTTTGTTGG + Intergenic
1053719606 9:40932348-40932370 TTGTCTCTTTTGAACTTTGTTGG + Intergenic
1054311165 9:63478842-63478864 TTGTCTCTTTAGATCTTTGTTGG + Intergenic
1054409948 9:64802994-64803016 TTGTCTCTTTAGATCTTTGTTGG + Intergenic
1056447745 9:86682570-86682592 TTTACTCTCTGGCCCTTTGCAGG - Intergenic
1058135217 9:101299690-101299712 TGCTTTCTGTAGCACTTTGCAGG + Intronic
1058271606 9:102979234-102979256 TTGTTCCTCTGGCATTTTGCTGG + Intergenic
1058595161 9:106607346-106607368 TTGTCTCTTTTGATCTTTGCTGG - Intergenic
1058954701 9:109934963-109934985 TTGTCTCTCAAGAATGTTGCGGG + Intronic
1059096133 9:111416824-111416846 TTGACTCTGTCCCACTTTGCCGG - Intronic
1059516654 9:114902254-114902276 TTGTCTCTCAACAACTTTGTGGG + Intronic
1060098932 9:120820461-120820483 TTGTGTCTCTGGACCTTTGCTGG - Intronic
1060305946 9:122412393-122412415 TTGTCTCTTTTGATCTTTGCTGG + Intergenic
1061330761 9:129890741-129890763 TTTTCTCTCTAGCCTTTAGCTGG + Intronic
1062069087 9:134545786-134545808 TTGTCTGTCTAGGACCCTGCTGG + Intergenic
1203370976 Un_KI270442v1:304352-304374 TTGTCTCTTTTGATCTTTGCTGG - Intergenic
1186586814 X:10884003-10884025 TTGTCTCTCTGGTACTTGGAAGG + Intergenic
1186659953 X:11659676-11659698 TTCTCTCTCTCGCTCTTTTCGGG - Intronic
1186883982 X:13894111-13894133 TTGTCTCTCTAGGACATCTCAGG + Intronic
1187769491 X:22679191-22679213 TTGTCTCTCTTGATCTTTGTTGG - Intergenic
1187835326 X:23427058-23427080 TTGTCTCTTTTGATCTTTGCTGG + Intergenic
1189256624 X:39645027-39645049 TCGTCTCTCCAGCTCTCTGCTGG - Intergenic
1189329812 X:40137117-40137139 TTGACTCTCTGGCATTGTGCCGG + Intronic
1189790434 X:44598628-44598650 CTGTAATTCTAGCACTTTGCGGG + Intergenic
1189934757 X:46056119-46056141 TTGTCTCTCTTGATCTTTGTTGG + Intergenic
1190493256 X:51003455-51003477 TTGTTTCCCTAGTACTCTGCTGG + Intergenic
1190536224 X:51431211-51431233 TTGTCTCTTTTGATCTTTGCTGG + Intergenic
1191048051 X:56160653-56160675 TTGTCTCTTTTGATCTTTGCTGG + Intergenic
1191186082 X:57613593-57613615 TTGTCTCTTTTGATCTTTGCTGG + Intergenic
1191203864 X:57814032-57814054 TTGTCTCTTTTGAACTTTGTTGG + Intergenic
1191804744 X:65122762-65122784 TTGTCTCTTTTGATCTTTGCTGG - Intergenic
1191935341 X:66421770-66421792 TTGTCTCTTTTGATCTTTGCTGG + Intergenic
1192984031 X:76377316-76377338 TTGTCTCTTTTGATCTTTGCTGG + Intergenic
1193029758 X:76884564-76884586 TTGTCTCTTTTGAACTTTGTTGG - Intergenic
1193733640 X:85131411-85131433 TTGTCTCTTTTGGTCTTTGCTGG + Intergenic
1194145949 X:90263146-90263168 TTGTATGTCTAGCACCTTGCAGG - Intergenic
1194148993 X:90299827-90299849 CTGTCTCTCTTGGACTTGGCTGG - Intergenic
1194231946 X:91335316-91335338 TTGTCTCTTTTGATCTTTGCTGG + Intergenic
1195826994 X:109012745-109012767 TTGTCTCTGTTGATCTTTGCTGG - Intergenic
1195827909 X:109023074-109023096 TTGTCTCTTTTGATCTTTGCTGG + Intergenic
1196094745 X:111786793-111786815 TTGTCTCTTTAGATCTTTGTTGG - Intronic
1196367572 X:114940975-114940997 TTGTCTCTTTTGAACTTTGTTGG + Intergenic
1196853838 X:119964147-119964169 TTGTCTCTTTAGATCTTTGTTGG - Intergenic
1197358906 X:125473272-125473294 CTGTATCTCTAGCACCTAGCAGG + Intergenic
1197991035 X:132317637-132317659 TTGTCTCTCTTGATCTTTGTTGG + Intergenic
1199686824 X:150272476-150272498 TTCTCTTTGTAGCACTTTACTGG - Intergenic
1200491694 Y:3832438-3832460 TTGTATGTCTAGCACCTTGCAGG - Intergenic
1200495364 Y:3876559-3876581 CTGTCTCTCTTGGACTTGGCTGG - Intergenic
1201522035 Y:14886300-14886322 TTGTCTCTTTTGATCTTTGCTGG + Intergenic
1201717714 Y:17064701-17064723 TTGTCTCTTTTGAACTTTGTTGG + Intergenic
1201785442 Y:17772106-17772128 CTGTATCTTCAGCACTTTGCGGG + Intergenic
1201816111 Y:18133881-18133903 CTGTATCTTCAGCACTTTGCGGG - Intergenic
1201942092 Y:19471298-19471320 TTGTCTCTTTAGATCTTTGTTGG + Intergenic
1201974833 Y:19837867-19837889 TTGTCTCTTTAGATCTTTGTTGG + Intergenic
1202072749 Y:21009674-21009696 TTGTCTCTCTTGATCTTTGTTGG + Intergenic
1202093843 Y:21222959-21222981 TTGCTTTTCTACCACTTTGCAGG - Intergenic
1202343306 Y:23891866-23891888 TTGTCTCTTTTGATCTTTGCTGG - Intergenic
1202527462 Y:25778219-25778241 TTGTCTCTTTTGATCTTTGCTGG + Intergenic