ID: 1012937502

View in Genome Browser
Species Human (GRCh38)
Location 6:105383563-105383585
Sequence CATCTGCTCTTGGGTGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 202}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012937497_1012937502 -3 Left 1012937497 6:105383543-105383565 CCATCTCTTCTCTCTGGGACCAT 0: 1
1: 0
2: 4
3: 63
4: 461
Right 1012937502 6:105383563-105383585 CATCTGCTCTTGGGTGAAAAGGG 0: 1
1: 0
2: 2
3: 15
4: 202
1012937492_1012937502 9 Left 1012937492 6:105383531-105383553 CCCAGAGTGGGCCCATCTCTTCT 0: 1
1: 0
2: 0
3: 10
4: 192
Right 1012937502 6:105383563-105383585 CATCTGCTCTTGGGTGAAAAGGG 0: 1
1: 0
2: 2
3: 15
4: 202
1012937496_1012937502 -2 Left 1012937496 6:105383542-105383564 CCCATCTCTTCTCTCTGGGACCA 0: 1
1: 0
2: 1
3: 40
4: 356
Right 1012937502 6:105383563-105383585 CATCTGCTCTTGGGTGAAAAGGG 0: 1
1: 0
2: 2
3: 15
4: 202
1012937493_1012937502 8 Left 1012937493 6:105383532-105383554 CCAGAGTGGGCCCATCTCTTCTC 0: 1
1: 0
2: 1
3: 14
4: 219
Right 1012937502 6:105383563-105383585 CATCTGCTCTTGGGTGAAAAGGG 0: 1
1: 0
2: 2
3: 15
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012937502 Original CRISPR CATCTGCTCTTGGGTGAAAA GGG Intronic
900620316 1:3584043-3584065 CATCTGCTCTAGGGTGAAACTGG + Intronic
901177871 1:7317919-7317941 CATCTCCCCTTGGCTTAAAAAGG - Intronic
902624042 1:17666639-17666661 CAGCTGTTCTTGGGGGAGAAAGG - Intronic
904569815 1:31454976-31454998 CATCTGCTCGGGGATGAACAAGG + Intergenic
904571095 1:31465779-31465801 CATCTGCTCCGGGATGAATAAGG - Intergenic
904700815 1:32357090-32357112 CATCTGCTCTTCTAAGAAAAAGG - Intronic
904915317 1:33966045-33966067 CACCTGCTCTGGGGAGACAAGGG + Intronic
906953511 1:50353195-50353217 GCACTGCTGTTGGGTGAAAAAGG - Intergenic
907512587 1:54972857-54972879 CATCAGCCCTTGGGTGAATGGGG + Intergenic
909725069 1:78825008-78825030 TATCTGCTCTGGGGTGAGCAAGG - Intergenic
910556514 1:88540437-88540459 TATCAGCTCTTGGGTTAATATGG + Intergenic
911357581 1:96841326-96841348 CATGTTCTCTTGAGTGATAAAGG - Intergenic
912259790 1:108098992-108099014 CAGCATCTCTTGGGTGGAAAGGG - Intergenic
913231954 1:116747258-116747280 CATCTGCTCTGGGATGAACAAGG - Intergenic
913297966 1:117340106-117340128 CCTCTGTTCTTGAGGGAAAATGG + Intergenic
916448040 1:164891931-164891953 CAGCTCCTCCTGGGGGAAAAAGG + Intronic
917687264 1:177429774-177429796 CTTCTACTCTTTGGAGAAAATGG + Intergenic
920943011 1:210501636-210501658 CAGCTGCTCCTGGGGAAAAATGG + Intronic
923282787 1:232460961-232460983 CATCTGCTCGTGGGTCAGAGTGG + Exonic
924459386 1:244244859-244244881 CACCTGTTCTTGGGAGAAGAGGG + Intergenic
1063567973 10:7189029-7189051 AAATTGCTCTTTGGTGAAAATGG - Intronic
1063989022 10:11539298-11539320 CATCAGATCTGGAGTGAAAAGGG - Intronic
1064864062 10:19859291-19859313 CATCTGCTATTGTGTGAATATGG - Intronic
1065120045 10:22520337-22520359 CGACAGCTCTTGGGTTAAAAGGG + Intergenic
1065223553 10:23520416-23520438 TATGTGTTCTGGGGTGAAAAGGG + Intergenic
1066662868 10:37753492-37753514 CATGTGCACTTGGGTGAAGAAGG - Intergenic
1066994527 10:42551980-42552002 CATCTGTTGTGGGGTGAGAAGGG - Intergenic
1068416835 10:56734152-56734174 CCTCTACTCATGGGTGAAAGGGG - Intergenic
1071751985 10:88489628-88489650 TATCTGTTCTTGTGAGAAAATGG - Intronic
1072235730 10:93451893-93451915 CATCTGCTATTGGCTTAGAAGGG + Intronic
1077703605 11:4463355-4463377 CATCTGCTCAGGGATGAACAAGG - Intergenic
1080593114 11:33740757-33740779 TAACTGTTCTTGGGGGAAAATGG + Intergenic
1080800904 11:35609415-35609437 CTTCTGCTATTGGGTAAAAGAGG - Intergenic
1081061078 11:38478436-38478458 TATCTGATCTTGTTTGAAAACGG - Intergenic
1081197598 11:40180273-40180295 CATCTGCACATATGTGAAAAAGG + Intronic
1083089961 11:60189654-60189676 CATCTGCTCTGGGATGAATAAGG - Intergenic
1084671299 11:70608098-70608120 CAGCTGCTCTTGTGGGAAATCGG + Intronic
1087030317 11:93697340-93697362 CTTTTGCTCATGGCTGAAAAGGG - Exonic
1087639955 11:100746141-100746163 CATCTGCTCAGGGATGAATAAGG + Intronic
1088083535 11:105950224-105950246 GATCTGGTCTTGGGTGATAAAGG + Intronic
1088842030 11:113635401-113635423 CAGCTGCTCTGGGGTGAGAGGGG - Intergenic
1089511316 11:118999001-118999023 CTTGTGCTCTGGGCTGAAAATGG - Exonic
1091207204 11:133830006-133830028 CCTCTTCTCTTTGGAGAAAAGGG + Intergenic
1092524147 12:9299326-9299348 CATCTGCTCGTGGTTGTAGAAGG - Intergenic
1092543121 12:9432486-9432508 CATCTGCTCGTGGTTGTAGAAGG + Intergenic
1094509898 12:31089952-31089974 CATCTGCTCGTGGTTGTAGAAGG - Exonic
1095162243 12:38932346-38932368 CATCTGCTCAGGGGTGAATAAGG + Intergenic
1095348033 12:41175822-41175844 CAGCTTCCCTTGGGTGAACAGGG - Intergenic
1095688467 12:45061919-45061941 CATTTTCTCTTAGGTGAAATGGG + Intergenic
1096479891 12:51932687-51932709 GATCTGCTCTCTGGTGGAAATGG + Intergenic
1096782615 12:53999833-53999855 CATCTGCTTATGGGTGGACATGG + Intronic
1098248463 12:68544438-68544460 CATCTGCTCAGGGATGAACAAGG - Intergenic
1099266898 12:80458889-80458911 AATCTGCTTTTTGGTGAAAATGG + Intronic
1103293830 12:119869169-119869191 CATCTGCTGTTGAGTCATAAAGG + Exonic
1103389425 12:120560621-120560643 CCTTTTCTCTGGGGTGAAAATGG - Intronic
1104039475 12:125120369-125120391 AATCTGTTCTTGGGGGAAACAGG + Intronic
1106576431 13:30979467-30979489 CCTGTGCTCTTGGGAGAAACGGG - Intergenic
1107906126 13:45062738-45062760 CATCCGATCTTGGGAGAAAAGGG + Intergenic
1108261005 13:48656522-48656544 CATGTGCTTTTGAGTTAAAAGGG - Intronic
1109119697 13:58439005-58439027 TATCTTTTCGTGGGTGAAAATGG + Intergenic
1110350672 13:74503487-74503509 CATTGTCTCATGGGTGAAAATGG + Intergenic
1113454568 13:110438895-110438917 CACCTGCTGCTGGGTGAAGACGG - Intronic
1114146227 14:19980879-19980901 CATCTGCTCGGGGATGAACAAGG - Intergenic
1115211493 14:30971160-30971182 CATCTGCTCGGGGATGAACAAGG - Intronic
1115825214 14:37264165-37264187 CATCTTCTCTTGGTTAGAAAAGG + Intronic
1116555542 14:46300271-46300293 CATCTGAGCTTGGGTGAACAGGG - Intergenic
1117396201 14:55312734-55312756 CATCCCCACTGGGGTGAAAATGG - Intronic
1119585601 14:75832072-75832094 CATCTGTTCTTTCGTAAAAAGGG - Intronic
1121743492 14:96269825-96269847 CTTCTGCTCATAGGAGAAAATGG - Intergenic
1122023106 14:98855683-98855705 CGTCTGCTCTTCTGTGAAATGGG - Intergenic
1122153766 14:99738343-99738365 CATATCCTCTAGGTTGAAAATGG + Intronic
1124212991 15:27778752-27778774 AATCTGCTCTTGCCTGGAAAAGG + Intronic
1124934333 15:34156105-34156127 CATCTGCTCGGGGGTGTATAAGG + Intronic
1124936473 15:34176883-34176905 CAAATGCTCTTGGTGGAAAAGGG - Intronic
1127098149 15:55534678-55534700 AATGTTTTCTTGGGTGAAAATGG + Intergenic
1127219022 15:56858177-56858199 AGTATGCTATTGGGTGAAAAAGG - Intronic
1128067330 15:64773606-64773628 CCACTGCTGTTGGGTGAGAAGGG - Intronic
1128377610 15:67088617-67088639 CAGCTGCTCTAGGGTGGGAAGGG + Intronic
1129761396 15:78131177-78131199 TAGCTGCTCTTCGGTGAAGATGG + Exonic
1130053137 15:80500414-80500436 CATCTTATCTTGGTTCAAAAAGG - Intronic
1131782498 15:95874769-95874791 CAACAGCTCTGGGGTGAAACTGG - Intergenic
1134125806 16:11615201-11615223 CATCTACCCTGGGGTGTAAATGG + Intronic
1134249023 16:12561541-12561563 CAACTGCTCATCAGTGAAAATGG - Intronic
1138228218 16:55317231-55317253 CAGCTGCTCATCTGTGAAAAGGG + Intergenic
1142096465 16:88242616-88242638 CATCTGCTCTGGGCTGAACTAGG - Intergenic
1146764238 17:35504837-35504859 CATCTGCTCAGGGATGAACAAGG - Intronic
1147810236 17:43163718-43163740 CATCTGCTCGGGGATGAACAAGG + Intergenic
1148828891 17:50416231-50416253 CATCTGCTCGGGGATGAACAAGG + Intergenic
1151017433 17:70572594-70572616 CAACTGCACTTTGGTGATAATGG - Intergenic
1151427645 17:74041465-74041487 CATCTCCCCTGGGGTGAGAATGG - Intergenic
1151448198 17:74180990-74181012 CTCCTGCTCTTGGGTGACGATGG - Intergenic
1153826301 18:8878217-8878239 CATCTGCTCGGGGATGAACAAGG + Intergenic
1154463352 18:14618454-14618476 CATCTGCTCAGGGATGAACAAGG - Intergenic
1154527620 18:15309463-15309485 CATCTGCTCAGGGGTGTAGAAGG + Intergenic
1157478524 18:48038158-48038180 CATCTGCTCTGGGGAGTAACAGG + Intronic
1160336581 18:78046420-78046442 CATCTGCCCTTCGGAGAACATGG - Intergenic
1161460092 19:4391437-4391459 CAACTGGTCTTTGGTGAACACGG + Intronic
1161485408 19:4532985-4533007 TATCTGCATTTGGTTGAAAAAGG + Intronic
1162185668 19:8903087-8903109 CATCTTCATTTGAGTGAAAACGG + Intronic
1163991924 19:21006852-21006874 CATCTGCTCAGGGATGAACAAGG - Intergenic
1164675600 19:30098340-30098362 CCTCTGCTCTTGGGTGTCTAAGG + Intergenic
1165509846 19:36259484-36259506 CATCTGCTCTTGGGGGACGTCGG + Intergenic
1167586329 19:50377674-50377696 CTTCTGCTCGTGTGTGATAAGGG - Intronic
925753397 2:7109990-7110012 AATCCGCTCTTAGATGAAAAAGG - Intergenic
926508113 2:13740974-13740996 CATCTTCTCTTGGCCGAAAGGGG + Intergenic
926711518 2:15885898-15885920 CATCTGATTTTGGTTGATAAAGG - Intergenic
928040284 2:27869069-27869091 CATCTTCTACTGGGTGAACATGG - Intronic
930681945 2:54266091-54266113 AATCAACTCTTGGGTCAAAAAGG + Intronic
932294071 2:70609762-70609784 CATTTGCTCTTGGGTGGGCAGGG + Intronic
935958838 2:108403912-108403934 CATCTGCTCAGGGATGAACAAGG - Intergenic
935970653 2:108527932-108527954 CATCCGCTCGGGGGTGAACAAGG - Intergenic
936419526 2:112349953-112349975 CATCCGCTCGGGGGTGAACAAGG + Intergenic
937767967 2:125683743-125683765 CATCTGCCCTAGGCTGAGAATGG + Intergenic
939340883 2:140894990-140895012 AATCAGATCTGGGGTGAAAAGGG + Intronic
940724962 2:157326579-157326601 AATCTGCCCTTGGGAGAAACAGG + Intronic
940956977 2:159738841-159738863 GACATGCTCCTGGGTGAAAAGGG - Intronic
945241830 2:207683153-207683175 CAACTGCTGTTGTGAGAAAAGGG - Intergenic
945519291 2:210803322-210803344 CATTTTCCCTTTGGTGAAAATGG - Intergenic
945793302 2:214331754-214331776 CATCTGCTTTTCTGTGAAGAAGG + Intronic
947411902 2:229850487-229850509 CATCTCTACTTGCGTGAAAAAGG - Intronic
948086722 2:235256682-235256704 CCTCTGCTCATGGGAGACAAAGG - Intergenic
948352757 2:237354410-237354432 CCTCTGCTCATGGGAGACAAAGG + Intronic
1173795035 20:45853977-45853999 CATCTGCTCTGGGGGTAACAGGG + Intronic
1174611407 20:51801367-51801389 CATTTGCGCTTGGGTGTGAAAGG - Intronic
1176811174 21:13539918-13539940 CATCTGCTCAGGGATGAACAAGG + Intergenic
1178811831 21:35890933-35890955 CTTCTGCTGTTGAGAGAAAAGGG - Intronic
1180871538 22:19149762-19149784 CAGCTGCTCTTCGCTGAAGATGG + Exonic
1180988370 22:19918802-19918824 CTTCTACTCTTGGGTGGAAGAGG - Intronic
1183996397 22:41636410-41636432 AAACAGCTCTGGGGTGAAAAAGG + Intronic
949609775 3:5692436-5692458 CATCTGCTCGGGGATGAACAAGG + Intergenic
950594176 3:13964408-13964430 CATCTGCTCGGGGATGAAAAAGG + Intronic
953674353 3:44989052-44989074 TATCTTCTCTAGGGGGAAAATGG + Intronic
954912124 3:54119586-54119608 TATAAGCTTTTGGGTGAAAATGG + Intergenic
956208325 3:66776880-66776902 CTACTCCTCTTGGGGGAAAATGG - Intergenic
956855531 3:73271235-73271257 AATCTGCTCTTGGGTTGAAGAGG + Intergenic
956942643 3:74181487-74181509 AAGCTCCTCCTGGGTGAAAATGG - Intergenic
958044533 3:88267366-88267388 CAGGTGCTCTTGAGAGAAAAGGG + Intergenic
958075336 3:88669048-88669070 GATCTGTTCTTGGCTGTAAATGG + Intergenic
958604599 3:96340748-96340770 CTTCTGGTCTTGGGTGCATATGG - Intergenic
962277138 3:134024096-134024118 CATCTGCTCGGGGATGAACAAGG - Intronic
967322535 3:188208683-188208705 CATTTGCTTTTAGCTGAAAAGGG + Intronic
970382348 4:15520669-15520691 CATCTGGTCTTGGGTTCAAGTGG - Intronic
971470856 4:27024973-27024995 CTGCTGCTCCTGGGTGAGAAGGG + Intronic
971827899 4:31651049-31651071 CATTCACTCTTTGGTGAAAAGGG - Intergenic
974949763 4:68573736-68573758 CATCTGCTCAGGGATGAACAAGG + Intronic
975685327 4:76915362-76915384 CATCTGCCCTTGGGTTATACTGG - Intergenic
978230376 4:106390432-106390454 CAGCTTCTCTTGTTTGAAAATGG - Intergenic
978963515 4:114713165-114713187 CATATACTTTTTGGTGAAAAAGG + Intergenic
979809551 4:125018954-125018976 CACTTGATCTTGGGTGACAAAGG - Intergenic
979875901 4:125890699-125890721 CATCTTCTCTTGGGTGAAGAGGG + Intergenic
987620708 5:20336236-20336258 TAACTGCTGTTGGGGGAAAAGGG - Intronic
989519645 5:42386239-42386261 AATCTGCTCCTGGGAGAAAATGG - Intergenic
989557661 5:42816230-42816252 CATCTGCTCAGGGATGAACAAGG - Intronic
989839471 5:46044341-46044363 CATGAGGTCTTTGGTGAAAAAGG + Intergenic
991012399 5:61897978-61898000 CATCTGGGGTTGGGTGATAAAGG + Intergenic
993113254 5:83685922-83685944 CATATGCTCTTGGCCAAAAATGG - Intronic
994705916 5:103206484-103206506 CATCTGCTCTAGGGTCAGTAAGG - Intronic
998681134 5:144468471-144468493 CAACTGCTCATGAGTAAAAACGG + Intronic
998827696 5:146120856-146120878 CAGCTTCTCTTTTGTGAAAAAGG - Intronic
998848064 5:146330018-146330040 AATGTGCTCTTTGGAGAAAAAGG + Intronic
1000236895 5:159370343-159370365 CATCTGCTCAGGGATGAATAAGG - Intergenic
1000929750 5:167237001-167237023 CATCTCCTCTTAGGTGCAGATGG + Intergenic
1001558365 5:172652020-172652042 CATCCGCTCTGGGATGAACAAGG + Intronic
1002999043 6:2313915-2313937 CATCTGCTCGGGGATGAACAAGG + Intergenic
1003267337 6:4577345-4577367 CATCAACGCTTTGGTGAAAATGG + Intergenic
1004502623 6:16222649-16222671 CTTCTGCTCTTTGCTTAAAATGG - Intergenic
1006471127 6:34229384-34229406 CAGCTGGTCCTGGGTGGAAAGGG + Intergenic
1009628148 6:66163010-66163032 CATCTGCTCGGGAGTGAACAAGG + Intergenic
1009797648 6:68492619-68492641 GAACTGTTCTTGGGAGAAAACGG + Intergenic
1011198943 6:84813313-84813335 CATCTGCACATGCGTGAGAAAGG + Intergenic
1012937502 6:105383563-105383585 CATCTGCTCTTGGGTGAAAAGGG + Intronic
1014152271 6:118071589-118071611 GATGTGCTCTAGGGGGAAAAAGG - Intronic
1016510014 6:144831791-144831813 CATCTGCCCTTGGGTGACACTGG + Intronic
1017320648 6:153088708-153088730 CATCTGCACTTGGGCAAATAAGG - Intronic
1019409930 7:901935-901957 CATCTCCTGCTGGGGGAAAAGGG - Intronic
1020043817 7:5024696-5024718 CATCTGCTCTGGGATGAACAAGG + Intronic
1022113523 7:27245183-27245205 AATCTGCTCTCGGGTGAAGGCGG - Exonic
1023285456 7:38614504-38614526 CATCTGCCCTTTGGAGAAATCGG + Intronic
1024813011 7:53235539-53235561 CATCTGCTCAGGGATGAACAAGG - Intergenic
1024915038 7:54489817-54489839 TAAAGGCTCTTGGGTGAAAAAGG - Intergenic
1028334097 7:89629598-89629620 CATCTGCTCGGGGATGAACAAGG - Intergenic
1029315226 7:99706136-99706158 CATCTTCTCTTGGTTTACAAGGG + Intronic
1029467782 7:100736958-100736980 CTGCTGCTCTCGGGTGAAGAGGG + Exonic
1029888616 7:103902092-103902114 CATCAGCTCCTTGCTGAAAAAGG + Intronic
1031865979 7:127039600-127039622 GGTCTGCTCTTGAGTGAGAAGGG + Intronic
1032067036 7:128779375-128779397 CCTCTGCTGTTGGGGGAACAGGG - Intergenic
1033050201 7:137997148-137997170 CAAGTGTTCTTGGGGGAAAAAGG - Intronic
1034236274 7:149572466-149572488 CATCTGCTTTGGGATGAATAAGG - Intergenic
1034353880 7:150435520-150435542 CATCTGCTCTGGGGTCACGAGGG + Intergenic
1035240797 7:157527943-157527965 CACCTGCTCTCGGGTGGAATCGG - Intergenic
1035440854 7:158898085-158898107 CATCTGCTCTCAGGTCACAATGG - Intronic
1037149732 8:15622059-15622081 CCTCTCCTCTCAGGTGAAAAAGG - Intronic
1039359832 8:36864111-36864133 CAAATGCACTTGGGTGAAATGGG + Intronic
1041243100 8:55865974-55865996 CATGAGCTCTGGGGTCAAAAAGG + Intergenic
1042091503 8:65164622-65164644 GATCTGCTTTGGGGGGAAAATGG - Intergenic
1044086543 8:87949341-87949363 CATCTGCTCTTCAGTGAAGGTGG + Intergenic
1045351397 8:101344023-101344045 CATTTTCTCATGTGTGAAAATGG - Intergenic
1046857267 8:119047236-119047258 CATCTGAGCTTTGGTGAAACTGG + Intronic
1048383757 8:133892326-133892348 CATCTGTTGTTGGGGAAAAAAGG + Intergenic
1049953398 9:668291-668313 GATCTGTTCATTGGTGAAAATGG + Intronic
1050673060 9:8019542-8019564 CATGTGCTCTTGGCTGATGATGG - Intergenic
1051647585 9:19284236-19284258 TATATACTCTTAGGTGAAAAAGG - Intronic
1051773466 9:20606570-20606592 CATCTTCTCTTGTCTGAAATTGG - Intronic
1051844111 9:21432289-21432311 CATCAGCTCTGAGGAGAAAAGGG - Intronic
1052342557 9:27378319-27378341 CATCTGGACATGGGTAAAAAGGG + Intronic
1055323801 9:75107505-75107527 TATCTGCTTTTGGGGGAAATGGG + Intronic
1055909097 9:81326976-81326998 CAACTGCTCTTGTGTGCAGAAGG + Intergenic
1056179495 9:84068163-84068185 CATCTACTCTTGCAAGAAAACGG - Intergenic
1057610284 9:96536815-96536837 CAACTACTCTGGGCTGAAAAGGG + Intronic
1059431258 9:114251761-114251783 CTTCAGCTCTTGGGTCAAGAGGG + Intronic
1060366749 9:123024058-123024080 CATTTGTCCTTGGGTTAAAATGG - Intronic
1186473071 X:9836226-9836248 CAGCTGCCCTTGGGTAAAAGTGG + Intronic
1186838647 X:13463285-13463307 CATCTGGTCTTCTGTGAAATGGG - Intergenic
1187237842 X:17484863-17484885 CAGCTCCTCTAGGGTGAACAAGG + Intronic
1189833748 X:45000560-45000582 CATCTGCTCGGGGATGAACAAGG + Intronic
1191917901 X:66222074-66222096 CATCTGCTCAGGGATGAACAAGG + Intronic
1196017830 X:110958267-110958289 CATCTGCTCTTGGCATAAAAAGG - Intronic
1197828773 X:130619350-130619372 CATCAGATCTTGGGTGGAAATGG - Intergenic
1200802562 Y:7399771-7399793 CATCTCCTCTGGGGTGGACAAGG - Intergenic
1201308982 Y:12577383-12577405 CATCTGCTCGGGGATGAACAAGG - Intergenic