ID: 1012938756

View in Genome Browser
Species Human (GRCh38)
Location 6:105395777-105395799
Sequence TGGATTTCTACAGCCTTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 167}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012938756_1012938759 -2 Left 1012938756 6:105395777-105395799 CCATCAAAGGCTGTAGAAATCCA 0: 1
1: 0
2: 0
3: 10
4: 167
Right 1012938759 6:105395798-105395820 CAGGTTATAGCCGATACTTCAGG 0: 1
1: 0
2: 0
3: 0
4: 37
1012938756_1012938761 14 Left 1012938756 6:105395777-105395799 CCATCAAAGGCTGTAGAAATCCA 0: 1
1: 0
2: 0
3: 10
4: 167
Right 1012938761 6:105395814-105395836 CTTCAGGTGAAGAAATCATCAGG 0: 1
1: 0
2: 1
3: 15
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012938756 Original CRISPR TGGATTTCTACAGCCTTTGA TGG (reversed) Intronic
902695453 1:18137684-18137706 TGGATTTCTACCACATATGAAGG + Intronic
903281526 1:22252779-22252801 TGGAATTGTACAGCCTTTCCTGG - Intergenic
904657567 1:32060640-32060662 TGGCTTTCCTCAGCCTTTTATGG - Intronic
906909138 1:49927259-49927281 TGGACTAATACAGCCTGTGATGG - Intronic
907027897 1:51139569-51139591 TGGATTTAAACTGCCTTTGTAGG + Intronic
907100939 1:51834950-51834972 TGGTTTTCTAAAGTATTTGAGGG - Intronic
907995915 1:59632548-59632570 GGGATTTGTACAGCCTTTAATGG - Intronic
912048771 1:105495593-105495615 TGAACTTCTACAGCTTTAGAAGG - Intergenic
912528094 1:110299712-110299734 TGGACTGCTACAGCCTCTGTTGG + Intergenic
918169592 1:181983816-181983838 TGGATTTCTAAAACCTCTGGAGG + Intergenic
918569511 1:185972244-185972266 AGGATTTCTACAAACTTTGAGGG - Intronic
919594503 1:199545477-199545499 TGGATCTCTTCAGACTTTGGAGG + Intergenic
920169086 1:204058906-204058928 GGGATTTCTTCAGCTGTTGAAGG - Intergenic
921260741 1:213383359-213383381 TGGATCTCCACAGCCCTCGAGGG + Intergenic
921969657 1:221134281-221134303 TGGATTGACACAGCCTTTGGTGG - Intergenic
922994512 1:229945147-229945169 TGGATTTTAACATCCTTTTAGGG - Intergenic
1063398169 10:5713088-5713110 TTGATTTCTACAACTTTTCACGG + Intronic
1066274958 10:33859653-33859675 TGTATCTCTACAGCCTCAGATGG - Intergenic
1070438857 10:76422698-76422720 TGAAGGCCTACAGCCTTTGATGG + Intronic
1074403638 10:113162763-113162785 TGCATTTCTGCTGTCTTTGAAGG + Intronic
1074548363 10:114419754-114419776 TGCATTTCTAGAGCTTTTGCAGG - Intergenic
1075583450 10:123639835-123639857 TCCATTTCTACAGCTTTAGAAGG - Intergenic
1075817775 10:125278987-125279009 TGGTTCTGTACATCCTTTGAGGG + Intergenic
1076221584 10:128737982-128738004 TAGATTTCCTCAGCCTTTGGTGG - Intergenic
1084565454 11:69926038-69926060 TGCCTTTCTCCTGCCTTTGATGG - Intergenic
1091145390 11:133274824-133274846 TTGTCTTCTACAGCATTTGAAGG - Intronic
1092567599 12:9685160-9685182 TGCTTTTCTTCAGCCTTTGCTGG - Intronic
1093485959 12:19652861-19652883 TGTATTTCTAGAGCTGTTGAGGG - Intronic
1093919957 12:24848804-24848826 TGGATTTCTCTACCCATTGAGGG + Intronic
1097293623 12:57941371-57941393 CGGGTTGTTACAGCCTTTGAGGG + Intergenic
1097447740 12:59693652-59693674 TGAATTTCAAAAGACTTTGAAGG + Intronic
1097679732 12:62637423-62637445 TACATTTCTACTGCCTTTTATGG - Intergenic
1098089054 12:66881568-66881590 TTGAGCTTTACAGCCTTTGAAGG + Intergenic
1099108868 12:78531340-78531362 TAGATTTCTCCAGGCTTTAAGGG - Intergenic
1099234714 12:80070200-80070222 TGAATATCTACAGTCTCTGAGGG - Intergenic
1103217348 12:119212166-119212188 TGGATGTCTTCAGGCTGTGAGGG + Intronic
1104136265 12:125941974-125941996 AGGATTTTTACATCCTTTGAAGG + Intergenic
1104175309 12:126325975-126325997 TGCTGTTCTACAGCCTTTGCTGG - Intergenic
1105589130 13:21775073-21775095 TTGACATCTACAGCCATTGACGG + Intergenic
1107193410 13:37618284-37618306 TGGATTTCTTTAGACTTTTATGG + Intergenic
1107241471 13:38239883-38239905 TGGTTTTTGACAGCCTTTCAAGG - Intergenic
1107386772 13:39918801-39918823 TTGATTTATACATCCTCTGAGGG + Intergenic
1110017307 13:70423627-70423649 AGTATTTTTACAGCCATTGATGG + Intergenic
1110316595 13:74115393-74115415 TTCTTTTCTAGAGCCTTTGAAGG - Intronic
1111668127 13:91295657-91295679 TGGATACCCACAGCCCTTGATGG + Intergenic
1111779394 13:92702520-92702542 TGGATTTCTATTGCTTCTGACGG - Intronic
1112218966 13:97468561-97468583 AGGATTTCAACAGAGTTTGAAGG - Exonic
1112941536 13:104867971-104867993 TTTATTTCTACTGACTTTGATGG + Intergenic
1113396996 13:109957073-109957095 TGGATTTCTCCTGGCTGTGAAGG + Intergenic
1115843728 14:37502439-37502461 TGCAGTTCTACAGCCTCTGCTGG + Intronic
1116301675 14:43191209-43191231 TGGATTTGTTGATCCTTTGAAGG - Intergenic
1118027620 14:61785728-61785750 TGGATTTTTTGAGTCTTTGATGG + Intronic
1118639830 14:67782069-67782091 TGGATTTCTCCACCTTTTCAAGG + Intronic
1120044677 14:79792752-79792774 TGGCTTTCAAAATCCTTTGAGGG + Intronic
1120574190 14:86160631-86160653 TCCATATCTTCAGCCTTTGATGG + Intergenic
1121545825 14:94762798-94762820 TTGATTTCGACAGACTTTGAAGG + Intergenic
1121999178 14:98632488-98632510 TGGAGTTCTAGAGCCTGTGGAGG + Intergenic
1123873316 15:24598082-24598104 TGGCTCTCTACAGCCATTCATGG + Intergenic
1124121262 15:26891242-26891264 AGGATGTCTGCAGCCTTTGTGGG - Intronic
1126078967 15:44939816-44939838 TGGATTTCTAGAGAATATGAAGG + Intergenic
1126111090 15:45175218-45175240 CGGATTTCCAAAGCCTTTGCAGG - Exonic
1126864583 15:52923021-52923043 TGGCTTTCAACAGCCATGGACGG + Intergenic
1127057875 15:55150971-55150993 TGGTTTTCTACGGGCGTTGAAGG + Intergenic
1130445615 15:83998610-83998632 GGGATTTGAACAGCCTTAGATGG + Intronic
1131671627 15:94626017-94626039 TTGATTTCTATATTCTTTGATGG + Intergenic
1136128454 16:28202727-28202749 TGGATATCTACAGCTGGTGAGGG + Intronic
1140738184 16:77917796-77917818 ATGATTTCTTCTGCCTTTGAGGG + Intronic
1140970026 16:80003971-80003993 TGGATTTCACCAACCTTTGCAGG - Intergenic
1142528831 17:564965-564987 TGGATTCCTATAGCCTTAAACGG - Intronic
1143959878 17:10707826-10707848 TGGATTCCTACAATCTCTGATGG - Intronic
1144164241 17:12592476-12592498 TTGATTACTGCAGGCTTTGAGGG + Intergenic
1144319895 17:14104943-14104965 TGGATTTTTCCATCCTTTGAAGG - Intronic
1145787348 17:27602910-27602932 GGGCTTTCTTCTGCCTTTGAAGG - Intronic
1146615691 17:34355709-34355731 TGGGTTTCTAGAGCTGTTGATGG - Intergenic
1150481310 17:65513630-65513652 TTTATTTCTACATCCATTGATGG + Intergenic
1152689951 17:81713435-81713457 TGTATTCCAGCAGCCTTTGAGGG + Intronic
1153159297 18:2184758-2184780 AGAATTTCTACAGGCTGTGATGG - Intergenic
1153660189 18:7319050-7319072 TGGATTTTTACAGCTGCTGAGGG - Intergenic
1156005060 18:32430506-32430528 TGGAGATCCACAGCCTTTTAAGG + Intronic
1163075465 19:14887067-14887089 TGTATTTCTGCAGACTGTGATGG - Intergenic
1164440737 19:28277086-28277108 TGGTTTACTACATCCTTTCAAGG - Intergenic
1165767147 19:38358663-38358685 TGGATTTGTGCATCCTTTGAAGG - Intronic
1167499889 19:49839827-49839849 TGGATTCCGAGAGCCTTTGGGGG - Intergenic
1167693390 19:51000856-51000878 TGAATAGCTACAGCCTTTGGGGG - Intronic
925430517 2:3788519-3788541 TTGATTTCTGAAGCCTTTGGGGG - Intronic
927185008 2:20475752-20475774 TGGATATCTGCAGCCTCAGATGG + Intergenic
929354057 2:40997823-40997845 TTAATTTCTACCCCCTTTGATGG - Intergenic
929891387 2:45921285-45921307 AGAATTCCTATAGCCTTTGAGGG + Intronic
931811197 2:65856648-65856670 TGGATTTCTACTTCCTGTTAAGG + Intergenic
933490827 2:82984345-82984367 AGGATTTCTAAAGCTGTTGATGG - Intergenic
935689244 2:105715592-105715614 TGGATTTCGACTGTCTTTGAAGG - Intergenic
936016908 2:108966366-108966388 TGCATTTCTTAAGGCTTTGAAGG - Intronic
940664070 2:156585372-156585394 TTTATTTCAAGAGCCTTTGAGGG + Exonic
940673319 2:156697369-156697391 AAGATTTTTACAGCCTTTGTTGG + Intergenic
941142143 2:161797393-161797415 TGAACTCCTACAGCATTTGATGG + Intronic
944941698 2:204635160-204635182 AGGATCTCAACAGTCTTTGATGG + Intronic
945010587 2:205458789-205458811 GAGATTTCTACAGCTTTTCAAGG - Intronic
945168288 2:206969102-206969124 TGGATTTCTATAGCCATTTCAGG - Intronic
945598231 2:211822946-211822968 TGGATTTCTGCTCCCTTTTATGG + Intronic
946228243 2:218276276-218276298 TGGTTTTATACAGCCATTGCAGG - Intronic
947107017 2:226678311-226678333 TTGAATTTTACAGCCCTTGAAGG - Intergenic
1171736810 20:28796012-28796034 TGGATATTTACAGCCTTTTGTGG - Intergenic
1172201721 20:33131729-33131751 CATATTTCTACAGCCTTTGGAGG - Intergenic
1173304570 20:41836001-41836023 AGGATTTATTCAGCTTTTGAAGG + Intergenic
1175729488 20:61344233-61344255 TGTATTCTTACACCCTTTGATGG + Intronic
1177004050 21:15648788-15648810 TGGCTTACTACAGCATTTAAGGG - Intergenic
1177792908 21:25739431-25739453 TGTTTTTCTAGAGCCTTCGAGGG + Intronic
1178771515 21:35509025-35509047 TTGATTTCTATTGCCTTTCAGGG - Intronic
1184435137 22:44468642-44468664 TGCATTTCTAGAGCCTCTGGAGG - Intergenic
1185319213 22:50192861-50192883 TGGACCTCAGCAGCCTTTGATGG + Intronic
949890078 3:8727280-8727302 AGGACTTCTACAGCTTTTGAGGG + Intronic
952597661 3:35038242-35038264 TTGTTTTCTACAGTCTTTAAAGG + Intergenic
953030250 3:39175248-39175270 TGGCTTCCCACAGCCTTTGGAGG + Intergenic
954003415 3:47575349-47575371 TCCATTTCTACAGCCTGTAAAGG + Intronic
958232135 3:90924291-90924313 TGGATTTTTACAGCGTTTTGAGG + Intergenic
958232241 3:90925990-90926012 TGGATTTTTACAGCGGTTGGAGG + Intergenic
958232742 3:90934486-90934508 TGGATTTTTACAGCGTTTTGAGG + Intergenic
958238897 3:91038121-91038143 TGGATTTTTACAGCCGTTCGGGG + Intergenic
958239615 3:91050014-91050036 TGGATTTTTACAGCCGTTCGGGG + Intergenic
958247364 3:91180003-91180025 TGGATTTTTACAGCGGTTGGAGG + Intergenic
958988073 3:100806459-100806481 TGGATTTTTATAGTCTTTCAAGG - Intronic
961228294 3:125274788-125274810 TGGTTTTCACCAACCTTTGAGGG + Intronic
962704822 3:138032899-138032921 TGGAATTCTACTGTCTTGGAAGG - Exonic
964047240 3:152343585-152343607 TCGATTTCTAACCCCTTTGATGG - Intronic
965910620 3:173770580-173770602 TGGATTCCTAATTCCTTTGAAGG + Intronic
970147150 4:13047974-13047996 TTGATTTCTACAGCCCTTTTGGG + Intergenic
973648900 4:52977816-52977838 TGAATTCCTACAGCCTAAGAAGG + Intronic
974066742 4:57085733-57085755 TGGTTTTCCACAGCCTTACAAGG + Intronic
976864312 4:89705849-89705871 TGTATTTCTTAAGCCTTTAAAGG + Intergenic
978969949 4:114791719-114791741 AAGATTTCTACAGTCTTTCACGG - Intergenic
980628439 4:135405849-135405871 TGAACCCCTACAGCCTTTGATGG - Intergenic
983709704 4:170698732-170698754 TGTTTTTCTATAGCCTTTCAGGG + Intergenic
983906886 4:173192618-173192640 TTTACTTCTACAGCCTTTCAAGG - Intronic
984687649 4:182689594-182689616 TGGATTTCTGCAGACTCTGCCGG - Intronic
986200327 5:5573320-5573342 TGCACTTCCGCAGCCTTTGAGGG - Intergenic
987794272 5:22607305-22607327 TGGACTAATACAGCCTGTGATGG - Intronic
991398989 5:66234347-66234369 TGCATTCCTGCAGCCTGTGAGGG - Intergenic
991405193 5:66294336-66294358 TGCATTCCCACAGCCTGTGAGGG + Intergenic
997422743 5:133782027-133782049 CTGTTTTCCACAGCCTTTGATGG - Intergenic
998595834 5:143528926-143528948 TTGATTTCTCCAGCTTTTCAAGG + Intergenic
1000360295 5:160440881-160440903 TGTGTGCCTACAGCCTTTGAAGG + Intergenic
1000557363 5:162742481-162742503 TGGATTTCTTGATCTTTTGAAGG + Intergenic
1004801190 6:19150313-19150335 CGGATTTGTACTGCCTATGAAGG + Intergenic
1006565927 6:34957034-34957056 TGAATCTCTGCAGCCTGTGAAGG - Intronic
1007243470 6:40443451-40443473 AGGACTTCCACGGCCTTTGAGGG + Intronic
1009954523 6:70436724-70436746 AGGATGTCTGCAGTCTTTGAAGG + Intronic
1011010945 6:82703511-82703533 AGGCTTTCTAAAGCCTTTGTTGG - Intergenic
1012152642 6:95774257-95774279 TGGATTTCTACTACCGTTGGTGG + Intergenic
1012447013 6:99316922-99316944 TTCATTTTTACTGCCTTTGAAGG + Intronic
1012938756 6:105395777-105395799 TGGATTTCTACAGCCTTTGATGG - Intronic
1013713616 6:112931269-112931291 TTGATTTCAACTGTCTTTGATGG + Intergenic
1021167350 7:17357858-17357880 TTAATTTCTACTGTCTTTGAAGG + Intergenic
1022231197 7:28414263-28414285 TGGATTTCTACAGCAATTTAAGG + Intronic
1022826753 7:34022385-34022407 CGCATTTCTACAGCCTCTTAGGG + Intronic
1027883957 7:83878930-83878952 TGCATTTCTAAACCCTTTCATGG - Intergenic
1029320373 7:99753378-99753400 TCTATTTCTACAGACTTAGAGGG - Intergenic
1029353763 7:100034728-100034750 TAGATTTCTACAGCTTTGGTAGG - Exonic
1036208152 8:6820176-6820198 TGGATCCCTACAGCATGTGATGG - Intronic
1042112428 8:65395066-65395088 TGGATTTCTACAAAGTTTAATGG + Intergenic
1042910556 8:73821641-73821663 TGAATTCCTACATCCTTTCACGG - Intronic
1043771946 8:84214338-84214360 TGGATTTATATAGCCTGGGATGG + Intronic
1045370225 8:101515507-101515529 TGGTTTTCAACAGACTCTGAAGG - Intronic
1050458340 9:5855421-5855443 TGTGATTCAACAGCCTTTGAGGG + Intergenic
1050598693 9:7229134-7229156 TGGAGTTGTCCAGCCTCTGAAGG + Intergenic
1051295106 9:15587155-15587177 TGGATTTCTACACTCTATGCCGG + Intronic
1058007139 9:99929173-99929195 TGGATTTGTAAATACTTTGAAGG + Intronic
1058856771 9:109070078-109070100 TGGATATCTTAAGCCTTTAAGGG - Intronic
1060377708 9:123132404-123132426 TGTATTTCTTTAGCCTTTGATGG + Intronic
1203384373 Un_KI270438v1:8696-8718 TGGATATTTACAGCCTTTTGTGG + Intergenic
1203384438 Un_KI270438v1:10053-10075 TGGATATTTACAGCCTTTTGTGG + Intergenic
1186520638 X:10203684-10203706 AGGATTTTTACAGCCTCTGTAGG - Intronic
1186562147 X:10623871-10623893 TGGATTTCTGAAACCTCTGAGGG - Intronic
1186653704 X:11589926-11589948 GGTAATTATACAGCCTTTGATGG + Intronic
1187985835 X:24809776-24809798 TGTATTTCTAAAGCTCTTGAAGG - Intronic
1190199141 X:48345289-48345311 TGGTTCTCTCCAGCCTTCGAAGG - Intergenic
1191568800 X:62579166-62579188 TGGATATTTACAGCCTTTTGTGG + Intergenic
1191741462 X:64439638-64439660 TAGATTACTTCACCCTTTGATGG + Intergenic
1198642209 X:138768877-138768899 TGGATCCCTAGAGCCTCTGAGGG + Intronic