ID: 1012943024

View in Genome Browser
Species Human (GRCh38)
Location 6:105436484-105436506
Sequence CTAACCTGGAATAAAATTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012943022_1012943024 -9 Left 1012943022 6:105436470-105436492 CCTGTAAGTTCTTACTAACCTGG No data
Right 1012943024 6:105436484-105436506 CTAACCTGGAATAAAATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012943024 Original CRISPR CTAACCTGGAATAAAATTTC TGG Intergenic
No off target data available for this crispr