ID: 1012943495

View in Genome Browser
Species Human (GRCh38)
Location 6:105441869-105441891
Sequence CCTTTATTATGTGCACTTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012943495_1012943498 -6 Left 1012943495 6:105441869-105441891 CCCTTAAGTGCACATAATAAAGG No data
Right 1012943498 6:105441886-105441908 TAAAGGCAAAGAACATAAGCTGG No data
1012943495_1012943499 -5 Left 1012943495 6:105441869-105441891 CCCTTAAGTGCACATAATAAAGG No data
Right 1012943499 6:105441887-105441909 AAAGGCAAAGAACATAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012943495 Original CRISPR CCTTTATTATGTGCACTTAA GGG (reversed) Intergenic
No off target data available for this crispr