ID: 1012943605

View in Genome Browser
Species Human (GRCh38)
Location 6:105442851-105442873
Sequence CTCCTCACTGTCCCCTGAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012943601_1012943605 16 Left 1012943601 6:105442812-105442834 CCAAATATATTTGCCTCTTCCAC No data
Right 1012943605 6:105442851-105442873 CTCCTCACTGTCCCCTGAATAGG No data
1012943602_1012943605 3 Left 1012943602 6:105442825-105442847 CCTCTTCCACTTCTCCAACACAA No data
Right 1012943605 6:105442851-105442873 CTCCTCACTGTCCCCTGAATAGG No data
1012943600_1012943605 24 Left 1012943600 6:105442804-105442826 CCTCACAGCCAAATATATTTGCC No data
Right 1012943605 6:105442851-105442873 CTCCTCACTGTCCCCTGAATAGG No data
1012943603_1012943605 -3 Left 1012943603 6:105442831-105442853 CCACTTCTCCAACACAAGCTCTC No data
Right 1012943605 6:105442851-105442873 CTCCTCACTGTCCCCTGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012943605 Original CRISPR CTCCTCACTGTCCCCTGAAT AGG Intergenic
No off target data available for this crispr