ID: 1012945322

View in Genome Browser
Species Human (GRCh38)
Location 6:105459859-105459881
Sequence CTGAGTGACCAGAATGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012945322_1012945326 2 Left 1012945322 6:105459859-105459881 CCTTCATCATTCTGGTCACTCAG No data
Right 1012945326 6:105459884-105459906 TCAAAACGTTAGATCTTGGAGGG No data
1012945322_1012945327 21 Left 1012945322 6:105459859-105459881 CCTTCATCATTCTGGTCACTCAG No data
Right 1012945327 6:105459903-105459925 AGGGACCTGAGAAGTTATAGAGG No data
1012945322_1012945325 1 Left 1012945322 6:105459859-105459881 CCTTCATCATTCTGGTCACTCAG No data
Right 1012945325 6:105459883-105459905 CTCAAAACGTTAGATCTTGGAGG No data
1012945322_1012945323 -2 Left 1012945322 6:105459859-105459881 CCTTCATCATTCTGGTCACTCAG No data
Right 1012945323 6:105459880-105459902 AGCCTCAAAACGTTAGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012945322 Original CRISPR CTGAGTGACCAGAATGATGA AGG (reversed) Intergenic
No off target data available for this crispr