ID: 1012951182

View in Genome Browser
Species Human (GRCh38)
Location 6:105519707-105519729
Sequence TTACCTCTCAGGTTGATACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012951182_1012951185 12 Left 1012951182 6:105519707-105519729 CCTTGTATCAACCTGAGAGGTAA No data
Right 1012951185 6:105519742-105519764 TCAATTCAACAAATGAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012951182 Original CRISPR TTACCTCTCAGGTTGATACA AGG (reversed) Intergenic