ID: 1012952198

View in Genome Browser
Species Human (GRCh38)
Location 6:105530178-105530200
Sequence CAGTTCATCTGGAAGCCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012952192_1012952198 -10 Left 1012952192 6:105530165-105530187 CCTTCCATTGGCCCAGTTCATCT No data
Right 1012952198 6:105530178-105530200 CAGTTCATCTGGAAGCCAGAGGG No data
1012952189_1012952198 8 Left 1012952189 6:105530147-105530169 CCTGACCAATTTCAGATACCTTC No data
Right 1012952198 6:105530178-105530200 CAGTTCATCTGGAAGCCAGAGGG No data
1012952190_1012952198 3 Left 1012952190 6:105530152-105530174 CCAATTTCAGATACCTTCCATTG No data
Right 1012952198 6:105530178-105530200 CAGTTCATCTGGAAGCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012952198 Original CRISPR CAGTTCATCTGGAAGCCAGA GGG Intergenic
No off target data available for this crispr