ID: 1012953688

View in Genome Browser
Species Human (GRCh38)
Location 6:105545659-105545681
Sequence GTGTGGATGAGGAGAGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012953688_1012953694 9 Left 1012953688 6:105545659-105545681 CCTTCTGCTCTCCTCATCCACAC No data
Right 1012953694 6:105545691-105545713 GAGACAGTTACTCAAGTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012953688 Original CRISPR GTGTGGATGAGGAGAGCAGA AGG (reversed) Intergenic
No off target data available for this crispr