ID: 1012960024

View in Genome Browser
Species Human (GRCh38)
Location 6:105612570-105612592
Sequence CTAGTTGACCAAGACCCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012960021_1012960024 14 Left 1012960021 6:105612533-105612555 CCACTCTTTTCTGTCTATCCTTA No data
Right 1012960024 6:105612570-105612592 CTAGTTGACCAAGACCCAGCTGG No data
1012960020_1012960024 17 Left 1012960020 6:105612530-105612552 CCTCCACTCTTTTCTGTCTATCC No data
Right 1012960024 6:105612570-105612592 CTAGTTGACCAAGACCCAGCTGG No data
1012960019_1012960024 18 Left 1012960019 6:105612529-105612551 CCCTCCACTCTTTTCTGTCTATC No data
Right 1012960024 6:105612570-105612592 CTAGTTGACCAAGACCCAGCTGG No data
1012960022_1012960024 -4 Left 1012960022 6:105612551-105612573 CCTTAACTCAAACCTCTGTCTAG No data
Right 1012960024 6:105612570-105612592 CTAGTTGACCAAGACCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012960024 Original CRISPR CTAGTTGACCAAGACCCAGC TGG Intergenic
No off target data available for this crispr