ID: 1012960208

View in Genome Browser
Species Human (GRCh38)
Location 6:105614475-105614497
Sequence AGAGATCTAGAAACATTAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012960208_1012960214 22 Left 1012960208 6:105614475-105614497 CCCTTTAATGTTTCTAGATCTCT No data
Right 1012960214 6:105614520-105614542 TTTTGCATCTTTGTCTTGGAAGG No data
1012960208_1012960213 18 Left 1012960208 6:105614475-105614497 CCCTTTAATGTTTCTAGATCTCT No data
Right 1012960213 6:105614516-105614538 CTTGTTTTGCATCTTTGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012960208 Original CRISPR AGAGATCTAGAAACATTAAA GGG (reversed) Intergenic
No off target data available for this crispr