ID: 1012960209

View in Genome Browser
Species Human (GRCh38)
Location 6:105614476-105614498
Sequence AAGAGATCTAGAAACATTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012960209_1012960213 17 Left 1012960209 6:105614476-105614498 CCTTTAATGTTTCTAGATCTCTT No data
Right 1012960213 6:105614516-105614538 CTTGTTTTGCATCTTTGTCTTGG No data
1012960209_1012960214 21 Left 1012960209 6:105614476-105614498 CCTTTAATGTTTCTAGATCTCTT No data
Right 1012960214 6:105614520-105614542 TTTTGCATCTTTGTCTTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012960209 Original CRISPR AAGAGATCTAGAAACATTAA AGG (reversed) Intergenic