ID: 1012960210

View in Genome Browser
Species Human (GRCh38)
Location 6:105614500-105614522
Sequence AAACAAGGATGTGTGCAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012960210_1012960214 -3 Left 1012960210 6:105614500-105614522 CCTACCTGCACACATCCTTGTTT No data
Right 1012960214 6:105614520-105614542 TTTTGCATCTTTGTCTTGGAAGG No data
1012960210_1012960215 10 Left 1012960210 6:105614500-105614522 CCTACCTGCACACATCCTTGTTT No data
Right 1012960215 6:105614533-105614555 TCTTGGAAGGACAAATAGCATGG No data
1012960210_1012960216 25 Left 1012960210 6:105614500-105614522 CCTACCTGCACACATCCTTGTTT No data
Right 1012960216 6:105614548-105614570 TAGCATGGTTCAGATAATGAAGG No data
1012960210_1012960213 -7 Left 1012960210 6:105614500-105614522 CCTACCTGCACACATCCTTGTTT No data
Right 1012960213 6:105614516-105614538 CTTGTTTTGCATCTTTGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012960210 Original CRISPR AAACAAGGATGTGTGCAGGT AGG (reversed) Intergenic
No off target data available for this crispr