ID: 1012960211

View in Genome Browser
Species Human (GRCh38)
Location 6:105614504-105614526
Sequence TGCAAAACAAGGATGTGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012960211_1012960214 -7 Left 1012960211 6:105614504-105614526 CCTGCACACATCCTTGTTTTGCA No data
Right 1012960214 6:105614520-105614542 TTTTGCATCTTTGTCTTGGAAGG 0: 2
1: 0
2: 0
3: 35
4: 368
1012960211_1012960217 30 Left 1012960211 6:105614504-105614526 CCTGCACACATCCTTGTTTTGCA No data
Right 1012960217 6:105614557-105614579 TCAGATAATGAAGGTTGTGCAGG No data
1012960211_1012960216 21 Left 1012960211 6:105614504-105614526 CCTGCACACATCCTTGTTTTGCA No data
Right 1012960216 6:105614548-105614570 TAGCATGGTTCAGATAATGAAGG No data
1012960211_1012960215 6 Left 1012960211 6:105614504-105614526 CCTGCACACATCCTTGTTTTGCA No data
Right 1012960215 6:105614533-105614555 TCTTGGAAGGACAAATAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012960211 Original CRISPR TGCAAAACAAGGATGTGTGC AGG (reversed) Intergenic