ID: 1012960212

View in Genome Browser
Species Human (GRCh38)
Location 6:105614515-105614537
Sequence CAAGACAAAGATGCAAAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012960212_1012960218 24 Left 1012960212 6:105614515-105614537 CCTTGTTTTGCATCTTTGTCTTG No data
Right 1012960218 6:105614562-105614584 TAATGAAGGTTGTGCAGGAGAGG No data
1012960212_1012960216 10 Left 1012960212 6:105614515-105614537 CCTTGTTTTGCATCTTTGTCTTG No data
Right 1012960216 6:105614548-105614570 TAGCATGGTTCAGATAATGAAGG No data
1012960212_1012960217 19 Left 1012960212 6:105614515-105614537 CCTTGTTTTGCATCTTTGTCTTG No data
Right 1012960217 6:105614557-105614579 TCAGATAATGAAGGTTGTGCAGG No data
1012960212_1012960219 28 Left 1012960212 6:105614515-105614537 CCTTGTTTTGCATCTTTGTCTTG No data
Right 1012960219 6:105614566-105614588 GAAGGTTGTGCAGGAGAGGAAGG No data
1012960212_1012960215 -5 Left 1012960212 6:105614515-105614537 CCTTGTTTTGCATCTTTGTCTTG No data
Right 1012960215 6:105614533-105614555 TCTTGGAAGGACAAATAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012960212 Original CRISPR CAAGACAAAGATGCAAAACA AGG (reversed) Intergenic
No off target data available for this crispr