ID: 1012960213

View in Genome Browser
Species Human (GRCh38)
Location 6:105614516-105614538
Sequence CTTGTTTTGCATCTTTGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012960210_1012960213 -7 Left 1012960210 6:105614500-105614522 CCTACCTGCACACATCCTTGTTT No data
Right 1012960213 6:105614516-105614538 CTTGTTTTGCATCTTTGTCTTGG No data
1012960207_1012960213 30 Left 1012960207 6:105614463-105614485 CCTATGCAAACACCCTTTAATGT No data
Right 1012960213 6:105614516-105614538 CTTGTTTTGCATCTTTGTCTTGG No data
1012960209_1012960213 17 Left 1012960209 6:105614476-105614498 CCTTTAATGTTTCTAGATCTCTT No data
Right 1012960213 6:105614516-105614538 CTTGTTTTGCATCTTTGTCTTGG No data
1012960208_1012960213 18 Left 1012960208 6:105614475-105614497 CCCTTTAATGTTTCTAGATCTCT No data
Right 1012960213 6:105614516-105614538 CTTGTTTTGCATCTTTGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012960213 Original CRISPR CTTGTTTTGCATCTTTGTCT TGG Intergenic