ID: 1012960214

View in Genome Browser
Species Human (GRCh38)
Location 6:105614520-105614542
Sequence TTTTGCATCTTTGTCTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012960209_1012960214 21 Left 1012960209 6:105614476-105614498 CCTTTAATGTTTCTAGATCTCTT No data
Right 1012960214 6:105614520-105614542 TTTTGCATCTTTGTCTTGGAAGG No data
1012960211_1012960214 -7 Left 1012960211 6:105614504-105614526 CCTGCACACATCCTTGTTTTGCA No data
Right 1012960214 6:105614520-105614542 TTTTGCATCTTTGTCTTGGAAGG No data
1012960208_1012960214 22 Left 1012960208 6:105614475-105614497 CCCTTTAATGTTTCTAGATCTCT No data
Right 1012960214 6:105614520-105614542 TTTTGCATCTTTGTCTTGGAAGG No data
1012960210_1012960214 -3 Left 1012960210 6:105614500-105614522 CCTACCTGCACACATCCTTGTTT No data
Right 1012960214 6:105614520-105614542 TTTTGCATCTTTGTCTTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012960214 Original CRISPR TTTTGCATCTTTGTCTTGGA AGG Intergenic
No off target data available for this crispr