ID: 1012960216

View in Genome Browser
Species Human (GRCh38)
Location 6:105614548-105614570
Sequence TAGCATGGTTCAGATAATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012960212_1012960216 10 Left 1012960212 6:105614515-105614537 CCTTGTTTTGCATCTTTGTCTTG No data
Right 1012960216 6:105614548-105614570 TAGCATGGTTCAGATAATGAAGG No data
1012960210_1012960216 25 Left 1012960210 6:105614500-105614522 CCTACCTGCACACATCCTTGTTT No data
Right 1012960216 6:105614548-105614570 TAGCATGGTTCAGATAATGAAGG No data
1012960211_1012960216 21 Left 1012960211 6:105614504-105614526 CCTGCACACATCCTTGTTTTGCA No data
Right 1012960216 6:105614548-105614570 TAGCATGGTTCAGATAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012960216 Original CRISPR TAGCATGGTTCAGATAATGA AGG Intergenic
No off target data available for this crispr