ID: 1012960217

View in Genome Browser
Species Human (GRCh38)
Location 6:105614557-105614579
Sequence TCAGATAATGAAGGTTGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012960211_1012960217 30 Left 1012960211 6:105614504-105614526 CCTGCACACATCCTTGTTTTGCA No data
Right 1012960217 6:105614557-105614579 TCAGATAATGAAGGTTGTGCAGG No data
1012960212_1012960217 19 Left 1012960212 6:105614515-105614537 CCTTGTTTTGCATCTTTGTCTTG No data
Right 1012960217 6:105614557-105614579 TCAGATAATGAAGGTTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012960217 Original CRISPR TCAGATAATGAAGGTTGTGC AGG Intergenic
No off target data available for this crispr