ID: 1012960484

View in Genome Browser
Species Human (GRCh38)
Location 6:105616679-105616701
Sequence GACAGCCCACTGTTTGCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012960478_1012960484 23 Left 1012960478 6:105616633-105616655 CCATGTACTCATGAGCTTTTGAT No data
Right 1012960484 6:105616679-105616701 GACAGCCCACTGTTTGCACCAGG No data
1012960482_1012960484 -5 Left 1012960482 6:105616661-105616683 CCTCATTCCATCTGTGGGGACAG No data
Right 1012960484 6:105616679-105616701 GACAGCCCACTGTTTGCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012960484 Original CRISPR GACAGCCCACTGTTTGCACC AGG Intergenic
No off target data available for this crispr