ID: 1012960488

View in Genome Browser
Species Human (GRCh38)
Location 6:105616708-105616730
Sequence GCTACATATCCTGTAAGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012960482_1012960488 24 Left 1012960482 6:105616661-105616683 CCTCATTCCATCTGTGGGGACAG No data
Right 1012960488 6:105616708-105616730 GCTACATATCCTGTAAGACCTGG No data
1012960486_1012960488 0 Left 1012960486 6:105616685-105616707 CCACTGTTTGCACCAGGCTAATT No data
Right 1012960488 6:105616708-105616730 GCTACATATCCTGTAAGACCTGG No data
1012960483_1012960488 17 Left 1012960483 6:105616668-105616690 CCATCTGTGGGGACAGCCCACTG No data
Right 1012960488 6:105616708-105616730 GCTACATATCCTGTAAGACCTGG No data
1012960485_1012960488 1 Left 1012960485 6:105616684-105616706 CCCACTGTTTGCACCAGGCTAAT No data
Right 1012960488 6:105616708-105616730 GCTACATATCCTGTAAGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012960488 Original CRISPR GCTACATATCCTGTAAGACC TGG Intergenic
No off target data available for this crispr