ID: 1012964129

View in Genome Browser
Species Human (GRCh38)
Location 6:105655322-105655344
Sequence AGTTATCCATAGAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012964129_1012964134 16 Left 1012964129 6:105655322-105655344 CCTGCCATCTTCTATGGATAACT No data
Right 1012964134 6:105655361-105655383 TCAGCTCTTGTCCTGGTACTGGG No data
1012964129_1012964132 9 Left 1012964129 6:105655322-105655344 CCTGCCATCTTCTATGGATAACT No data
Right 1012964132 6:105655354-105655376 TTGAGAATCAGCTCTTGTCCTGG No data
1012964129_1012964133 15 Left 1012964129 6:105655322-105655344 CCTGCCATCTTCTATGGATAACT No data
Right 1012964133 6:105655360-105655382 ATCAGCTCTTGTCCTGGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012964129 Original CRISPR AGTTATCCATAGAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr