ID: 1012965056

View in Genome Browser
Species Human (GRCh38)
Location 6:105665122-105665144
Sequence ATGAATAAGCTTAATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012965056_1012965058 4 Left 1012965056 6:105665122-105665144 CCTTCCTCATTAAGCTTATTCAT No data
Right 1012965058 6:105665149-105665171 AGCTTTTGATTTAAAGTGAGAGG 0: 27
1: 40
2: 51
3: 58
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012965056 Original CRISPR ATGAATAAGCTTAATGAGGA AGG (reversed) Intergenic
No off target data available for this crispr