ID: 1012965261

View in Genome Browser
Species Human (GRCh38)
Location 6:105667081-105667103
Sequence TTCACCGGATTCCACACATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 62}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012965261_1012965264 10 Left 1012965261 6:105667081-105667103 CCAGATGTGTGGAATCCGGTGAA 0: 1
1: 0
2: 0
3: 2
4: 62
Right 1012965264 6:105667114-105667136 ACATCACTTACGTTTTCTCCGGG 0: 1
1: 0
2: 1
3: 5
4: 113
1012965261_1012965263 9 Left 1012965261 6:105667081-105667103 CCAGATGTGTGGAATCCGGTGAA 0: 1
1: 0
2: 0
3: 2
4: 62
Right 1012965263 6:105667113-105667135 AACATCACTTACGTTTTCTCCGG 0: 1
1: 0
2: 0
3: 11
4: 122
1012965261_1012965265 14 Left 1012965261 6:105667081-105667103 CCAGATGTGTGGAATCCGGTGAA 0: 1
1: 0
2: 0
3: 2
4: 62
Right 1012965265 6:105667118-105667140 CACTTACGTTTTCTCCGGGAAGG 0: 1
1: 0
2: 0
3: 2
4: 44
1012965261_1012965266 25 Left 1012965261 6:105667081-105667103 CCAGATGTGTGGAATCCGGTGAA 0: 1
1: 0
2: 0
3: 2
4: 62
Right 1012965266 6:105667129-105667151 TCTCCGGGAAGGATCTTAAAAGG 0: 1
1: 0
2: 1
3: 6
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012965261 Original CRISPR TTCACCGGATTCCACACATC TGG (reversed) Intergenic
901611097 1:10498895-10498917 TTCACAGGTTTTCACAGATCTGG - Intronic
911928384 1:103867070-103867092 TTCAGATGAATCCACACATCAGG - Intergenic
915276057 1:154789047-154789069 TGAAACTGATTCCACACATCTGG - Intronic
916459728 1:165011023-165011045 TCCACAGGATTGCAAACATCTGG + Intergenic
916574798 1:166057869-166057891 TTCACCGGCTGCCAGCCATCTGG - Intronic
1063180652 10:3596048-3596070 CTCCCAGGATTCCGCACATCTGG + Intergenic
1064877159 10:20007136-20007158 TTCACTGAATTCCACAACTCAGG + Intronic
1065445752 10:25796443-25796465 TTCACCAAAGTTCACACATCTGG - Intergenic
1072799104 10:98380475-98380497 TTCCCCTCATTCCAGACATCAGG + Intergenic
1078903711 11:15665068-15665090 TTCAGTTGATTCCACACATTTGG + Intergenic
1085737967 11:79055962-79055984 ATCCCTGGACTCCACACATCTGG + Intronic
1086805614 11:91238531-91238553 ATCATTAGATTCCACACATCTGG - Intergenic
1090446480 11:126768898-126768920 TTCACCGGCTCCCACGCATGTGG - Intronic
1091307358 11:134544879-134544901 TTCCCAGGATTCCATACAGCAGG - Intergenic
1092351570 12:7760244-7760266 TTCACCGGATTAGTCACCTCTGG + Intergenic
1094402525 12:30077439-30077461 TTCATCAGATTCCAAACTTCAGG + Intergenic
1100226014 12:92556357-92556379 TTCAAAGGATTCCACAGAACAGG - Intergenic
1113752841 13:112788184-112788206 TCCACAGGAGTCTACACATCAGG - Intronic
1113752977 13:112789158-112789180 TCCACAGGAGTCTACACATCAGG - Intronic
1113753075 13:112789778-112789800 TCCACAGGAGTCTACACATCAGG - Intronic
1113753211 13:112790694-112790716 TCCACAGGAGTCTACACATCAGG - Intronic
1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG + Intronic
1122116625 14:99530793-99530815 TTCACCTGAAGCCACACAGCAGG + Intronic
1132708476 16:1256392-1256414 CTCACCACATTCCACAGATCAGG + Intronic
1147285356 17:39398627-39398649 TCCACAGGATGCTACACATCTGG + Intronic
1152324305 17:79626720-79626742 TTCACCGCATTGCAAACATGCGG - Intergenic
1155710430 18:28870426-28870448 TTCACAGCATTCAAGACATCTGG + Intergenic
1160355500 18:78225077-78225099 TTCATCGCATTCCACACATTGGG - Intergenic
1163639396 19:18452784-18452806 TTCTCCTGAGGCCACACATCTGG - Intronic
1167643276 19:50693527-50693549 TTCACTGGATCCCACACACAGGG + Intronic
1167669434 19:50841328-50841350 TGCACCTGACTCCACACCTCAGG + Intergenic
933613871 2:84463849-84463871 CTGACTGGATTCCACACATGAGG - Intergenic
937832474 2:126438418-126438440 TTCATAGTGTTCCACACATCGGG + Intergenic
940749132 2:157604410-157604432 TTCACCATGTTGCACACATCAGG + Intronic
948753523 2:240145687-240145709 CTCACCGGATTCTGCACAGCTGG + Intergenic
1171432603 20:25093047-25093069 TTCACTGCATTCCACACATTTGG - Intergenic
1172844017 20:37919070-37919092 TTCCCAGGATGCCACAGATCAGG - Intronic
1179621350 21:42618225-42618247 TCCAAAAGATTCCACACATCTGG + Intergenic
1180875768 22:19174617-19174639 TTCCCGGGATTCCAGGCATCTGG + Intergenic
956144288 3:66176774-66176796 CTCATCGGATTCTACAAATCAGG - Intronic
956733367 3:72217134-72217156 CTCTCAGGTTTCCACACATCTGG - Intergenic
958080494 3:88740416-88740438 TTCACCAGAATCAAAACATCAGG - Intergenic
966944744 3:184769977-184769999 TTCAGCTGAGTCAACACATCGGG - Intergenic
974788601 4:66655844-66655866 TTCAAGGGATTGGACACATCAGG - Intergenic
977900577 4:102417717-102417739 TACACTAGATTCCTCACATCTGG - Intronic
978625788 4:110683919-110683941 TTCTCAGGCTCCCACACATCGGG + Intergenic
978665825 4:111181015-111181037 TTCACTGTATTCCACAGATTTGG + Intergenic
988486839 5:31674519-31674541 TTCAGCGGTTTCTAGACATCTGG - Intronic
989582705 5:43047927-43047949 TTCACCAGATTCCACAGAGTGGG + Intergenic
993350206 5:86841100-86841122 TTAACCAGATGCCACACATGTGG - Intergenic
1002037760 5:176485946-176485968 TTCATCAGATGCCACTCATCAGG + Intronic
1009397193 6:63213256-63213278 TTCTCAGGAAACCACACATCAGG + Intergenic
1011246373 6:85325385-85325407 TTGACAGGATTCTACCCATCTGG - Intergenic
1012476089 6:99615745-99615767 TTCACAGGCTCCCAAACATCAGG + Intergenic
1012965261 6:105667081-105667103 TTCACCGGATTCCACACATCTGG - Intergenic
1024672233 7:51606719-51606741 ACCACCGGCTTCCTCACATCCGG - Intergenic
1030852306 7:114504767-114504789 TCCACATGATTCCAAACATCTGG - Intronic
1034381323 7:150696198-150696220 TTTACTGGATGCCAGACATCTGG - Intergenic
1034504962 7:151481395-151481417 TTCACTGGCTTCCACATTTCAGG - Intronic
1043880938 8:85542210-85542232 TTCATCGGATTGCACAGACCTGG - Intergenic
1044793088 8:95867800-95867822 TTCCCCGGTTTCCACACAATGGG + Intergenic
1059851830 9:118350288-118350310 CTCACAGAAATCCACACATCAGG + Intergenic
1061669352 9:132179964-132179986 TTCACAGGGATCCACACACCTGG - Intronic
1194549242 X:95274888-95274910 TTCAGTGGATTCCAAACCTCAGG + Intergenic
1197685393 X:129434370-129434392 TTCACCTGTTTCCTGACATCTGG + Intergenic