ID: 1012969312

View in Genome Browser
Species Human (GRCh38)
Location 6:105710551-105710573
Sequence AACTCCTGCTCTCCTTCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012969312_1012969315 -6 Left 1012969312 6:105710551-105710573 CCCCATGAAGGAGAGCAGGAGTT No data
Right 1012969315 6:105710568-105710590 GGAGTTCCTACAAAACAGAAAGG No data
1012969312_1012969317 24 Left 1012969312 6:105710551-105710573 CCCCATGAAGGAGAGCAGGAGTT No data
Right 1012969317 6:105710598-105710620 TTTCCCCAAATGCCCAACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012969312 Original CRISPR AACTCCTGCTCTCCTTCATG GGG (reversed) Intergenic
No off target data available for this crispr