ID: 1012971180

View in Genome Browser
Species Human (GRCh38)
Location 6:105732731-105732753
Sequence CAGACTAGCAGGCGCGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012971175_1012971180 15 Left 1012971175 6:105732693-105732715 CCAATGCCAACTGCCTACAATTA No data
Right 1012971180 6:105732731-105732753 CAGACTAGCAGGCGCGTGGAAGG No data
1012971174_1012971180 16 Left 1012971174 6:105732692-105732714 CCCAATGCCAACTGCCTACAATT No data
Right 1012971180 6:105732731-105732753 CAGACTAGCAGGCGCGTGGAAGG No data
1012971176_1012971180 9 Left 1012971176 6:105732699-105732721 CCAACTGCCTACAATTAGTTAAC No data
Right 1012971180 6:105732731-105732753 CAGACTAGCAGGCGCGTGGAAGG No data
1012971177_1012971180 2 Left 1012971177 6:105732706-105732728 CCTACAATTAGTTAACTTTATTA No data
Right 1012971180 6:105732731-105732753 CAGACTAGCAGGCGCGTGGAAGG No data
1012971173_1012971180 17 Left 1012971173 6:105732691-105732713 CCCCAATGCCAACTGCCTACAAT No data
Right 1012971180 6:105732731-105732753 CAGACTAGCAGGCGCGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012971180 Original CRISPR CAGACTAGCAGGCGCGTGGA AGG Intergenic
No off target data available for this crispr