ID: 1012976167

View in Genome Browser
Species Human (GRCh38)
Location 6:105783401-105783423
Sequence ATGGAGTGCTAGAAGAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012976167_1012976171 22 Left 1012976167 6:105783401-105783423 CCAGCACTCTTCTAGCACTCCAT No data
Right 1012976171 6:105783446-105783468 TACAATCCTGTGAGACTGGGAGG No data
1012976167_1012976170 19 Left 1012976167 6:105783401-105783423 CCAGCACTCTTCTAGCACTCCAT No data
Right 1012976170 6:105783443-105783465 TCTTACAATCCTGTGAGACTGGG No data
1012976167_1012976169 18 Left 1012976167 6:105783401-105783423 CCAGCACTCTTCTAGCACTCCAT No data
Right 1012976169 6:105783442-105783464 TTCTTACAATCCTGTGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012976167 Original CRISPR ATGGAGTGCTAGAAGAGTGC TGG (reversed) Intergenic
No off target data available for this crispr