ID: 1012976384

View in Genome Browser
Species Human (GRCh38)
Location 6:105784919-105784941
Sequence GGACTTCATGGGCCACCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012976384_1012976391 28 Left 1012976384 6:105784919-105784941 CCTGCTGGTGGCCCATGAAGTCC No data
Right 1012976391 6:105784970-105784992 CCAGCCCCTCAGTATCCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012976384 Original CRISPR GGACTTCATGGGCCACCAGC AGG (reversed) Intergenic
No off target data available for this crispr