ID: 1012977670

View in Genome Browser
Species Human (GRCh38)
Location 6:105797370-105797392
Sequence ACCTGTGAGCTAGACATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012977670_1012977674 -5 Left 1012977670 6:105797370-105797392 CCTTCCATGTCTAGCTCACAGGT No data
Right 1012977674 6:105797388-105797410 CAGGTTTGCCTGAGGGACACAGG No data
1012977670_1012977676 5 Left 1012977670 6:105797370-105797392 CCTTCCATGTCTAGCTCACAGGT No data
Right 1012977676 6:105797398-105797420 TGAGGGACACAGGAGATAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012977670 Original CRISPR ACCTGTGAGCTAGACATGGA AGG (reversed) Intergenic
No off target data available for this crispr