ID: 1012978887

View in Genome Browser
Species Human (GRCh38)
Location 6:105809440-105809462
Sequence ACTTCTATTGGGCCACTAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012978884_1012978887 1 Left 1012978884 6:105809416-105809438 CCAGCAGAAGGAGCAGATAATTC No data
Right 1012978887 6:105809440-105809462 ACTTCTATTGGGCCACTAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012978887 Original CRISPR ACTTCTATTGGGCCACTAGC CGG Intergenic
No off target data available for this crispr