ID: 1012979755

View in Genome Browser
Species Human (GRCh38)
Location 6:105816991-105817013
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012979755_1012979759 18 Left 1012979755 6:105816991-105817013 CCATTTCCAGGAACGCTCATGTG No data
Right 1012979759 6:105817032-105817054 TTTAAATGTTCACTTACACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012979755 Original CRISPR CACATGAGCGTTCCTGGAAA TGG (reversed) Intergenic
No off target data available for this crispr