ID: 1012980183

View in Genome Browser
Species Human (GRCh38)
Location 6:105821225-105821247
Sequence TAATCCCTTGGGTATAGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012980183_1012980190 25 Left 1012980183 6:105821225-105821247 CCTACTCTATACCCAAGGGATTA No data
Right 1012980190 6:105821273-105821295 CAAGACAACACAAGTCAGGGAGG No data
1012980183_1012980188 22 Left 1012980183 6:105821225-105821247 CCTACTCTATACCCAAGGGATTA No data
Right 1012980188 6:105821270-105821292 GGCCAAGACAACACAAGTCAGGG No data
1012980183_1012980186 1 Left 1012980183 6:105821225-105821247 CCTACTCTATACCCAAGGGATTA No data
Right 1012980186 6:105821249-105821271 CACAGACAAGTGTAATGACTTGG No data
1012980183_1012980187 21 Left 1012980183 6:105821225-105821247 CCTACTCTATACCCAAGGGATTA No data
Right 1012980187 6:105821269-105821291 TGGCCAAGACAACACAAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012980183 Original CRISPR TAATCCCTTGGGTATAGAGT AGG (reversed) Intergenic
No off target data available for this crispr