ID: 1012982439

View in Genome Browser
Species Human (GRCh38)
Location 6:105844377-105844399
Sequence GGGTCTTGGCCTAGATGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012982439_1012982451 30 Left 1012982439 6:105844377-105844399 CCCTGGCATCTAGGCCAAGACCC No data
Right 1012982451 6:105844430-105844452 AGCCATGTTTCCCAGGGCGCAGG No data
1012982439_1012982448 24 Left 1012982439 6:105844377-105844399 CCCTGGCATCTAGGCCAAGACCC No data
Right 1012982448 6:105844424-105844446 ACACCCAGCCATGTTTCCCAGGG No data
1012982439_1012982447 23 Left 1012982439 6:105844377-105844399 CCCTGGCATCTAGGCCAAGACCC No data
Right 1012982447 6:105844423-105844445 AACACCCAGCCATGTTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012982439 Original CRISPR GGGTCTTGGCCTAGATGCCA GGG (reversed) Intergenic
No off target data available for this crispr