ID: 1012986350

View in Genome Browser
Species Human (GRCh38)
Location 6:105880408-105880430
Sequence GGGCGCGTGTGCTCCGGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012986350_1012986357 26 Left 1012986350 6:105880408-105880430 CCTGTGCCGGAGCACACGCGCCC No data
Right 1012986357 6:105880457-105880479 TCGGATCTGACTCCTGAAGCAGG No data
1012986350_1012986356 7 Left 1012986350 6:105880408-105880430 CCTGTGCCGGAGCACACGCGCCC No data
Right 1012986356 6:105880438-105880460 TACTGACACTCTTCACGTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012986350 Original CRISPR GGGCGCGTGTGCTCCGGCAC AGG (reversed) Intergenic