ID: 1012986436

View in Genome Browser
Species Human (GRCh38)
Location 6:105881219-105881241
Sequence ACTTATATTAAGAAACCGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012986432_1012986436 17 Left 1012986432 6:105881179-105881201 CCGTATTAATTATGAGTCATTTA No data
Right 1012986436 6:105881219-105881241 ACTTATATTAAGAAACCGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012986436 Original CRISPR ACTTATATTAAGAAACCGGA GGG Intergenic
No off target data available for this crispr