ID: 1012986848

View in Genome Browser
Species Human (GRCh38)
Location 6:105884774-105884796
Sequence CTTTGAGGAGGGCTGAGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012986848_1012986860 27 Left 1012986848 6:105884774-105884796 CCCAACCTCAGCCCTCCTCAAAG No data
Right 1012986860 6:105884824-105884846 AGCTCCTTGCTCCTCCCCATGGG No data
1012986848_1012986859 26 Left 1012986848 6:105884774-105884796 CCCAACCTCAGCCCTCCTCAAAG No data
Right 1012986859 6:105884823-105884845 CAGCTCCTTGCTCCTCCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012986848 Original CRISPR CTTTGAGGAGGGCTGAGGTT GGG (reversed) Intergenic
No off target data available for this crispr