ID: 1012986851

View in Genome Browser
Species Human (GRCh38)
Location 6:105884785-105884807
Sequence TGTGGCAGGCACTTTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012986851_1012986859 15 Left 1012986851 6:105884785-105884807 CCCTCCTCAAAGTGCCTGCCACA No data
Right 1012986859 6:105884823-105884845 CAGCTCCTTGCTCCTCCCCATGG No data
1012986851_1012986862 24 Left 1012986851 6:105884785-105884807 CCCTCCTCAAAGTGCCTGCCACA No data
Right 1012986862 6:105884832-105884854 GCTCCTCCCCATGGGATACCAGG No data
1012986851_1012986860 16 Left 1012986851 6:105884785-105884807 CCCTCCTCAAAGTGCCTGCCACA No data
Right 1012986860 6:105884824-105884846 AGCTCCTTGCTCCTCCCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012986851 Original CRISPR TGTGGCAGGCACTTTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr